Transcript

crispld1b-201

ID
ZDB-TSCRIPT-090929-10070
Name
crispld1b-201
Previous Names
  • crispld1-001
  • crispld1b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027517 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027517|OTTDARG00000021589|ZDB-GENE-040426-1204 crispld1b|OTTDARP00000022538 DKEY-82K12.5-001 LG_ CR788254.10 Danio rerio protein_coding NOVEL, 1979 bp
AAACATTTTGACTTCATTAATTTACTCGTGCGCAATGACT
CATGATGACTCATTCACGAAGAAAGGTGCAAACTGACTGA
AAAAGATGGACACCTGTATCTGAGATGCAAAAACTTCAGA
GAATCGCTATTTCAGTAAATCAGCACCGGAGCTAAAACAT
CATCAGTGACGCGCGGAGCTGCAGAAGGCAGAGGACAGGG
ATCACTTTGGATTTTGTGGCTGACAGGTGTGAAGGAAACA
TGAAGTGTGGACATTTGGAAGATTTATTTAGTGGCTTTGT
GCTGCTTGTGACTGTCCAAACTGTGGTTTCCATGGTGATT
CCCAATGCCACCCACTTAGAAGCCATCCTGGAAAAATACA
TGGATAAGGATGAGACTTGGTGGCAATCCAAGTCAAGGGG
CAAGAGAGCAATTTCACAAAGTGATATGCAACTCATTCTT
GACCTGCATAATAAGCTGAGGGGTCAAGTGTACCCACCTG
CCTCAAACATGGAATACATGGTGTGGGACACTGAACTTGA
GAGGAGTGCTGAGCACTGGGCTCACACTTGTCTGTGGGAA
CATGGACCGTCTCACCTACTGACCCGGATCGGCCAGAACC
TGGGAGCTCACTGGGGCAGAGACAGACCCCCAACTTTTCA
CGTCCAGGCCTGGTATGATGAGGTGAGAGATTTCAGCTAC
CCTTATCCTCAAGAGTGTAACCCTCACTGCCCCTACAGAT
GCTCTGGACCTGTCTGCACACATTACACACAGCTGGTTTG
GGCCACAAGCAACAAAATTGGCTGTGCTATCAATGTGTGC
TACAACATGAATGTATGGGGCATGATTTGGGCAAAAGCTG
TGTATCTGGTCTGCAATTACTCTCCCCCAGGTAACTGGTG
GGGACACGCACCATACAAGCATGGGACTCCTTGCTCCGCA
TGCCCACCCAGCTATGGGGGCGGCTGCAGAAACAACCTCT
GCTATAAAGATGATGGCAGTAATTATCATTACACTCCTGA
AACAGAGGAAAATAACTACATCGAACCAGAACCAGAGCCA
GTTCGAAGCCACGACACTCACTACAGAGATGAAACCACGA
CACCTTCTCCCAATGAGAACATCGAGAGGAATGAAGTCTC
CAGTACTTCCCAGATGTCTCAGCAAGTAGCGTGTGATACT
AGATTACGTGATCAATGCAAAGGAACCACTTGTAACAGGT
ACGAGTGTCCACCAGGCTGCTTTTACAACTATGGAAAAGT
AATTGGATCTGGTCATTATGACATGCAATCCAGTATCTGT
GGCAGCGGCTTGCATGCTGGAATAATAGATGATGACGGTG
GCTGGCTGGATATCACCAGAGTGGGCAGAAGGCAGCGCTT
CTCAAAGTCCTTCAAAAATGGAGTTCAGACTCTAGCGAAA
AATCAGAGTGCCAATGCCTTCACTGTATCAAATGTTCCAG
TAAAGGCAGTGAATTGTGAAACCACTGTGGCACAATTCTG
TCCATTCAAGAAACCAGTACGCCACTGTCCTAGGTTGTAC
TGTCCTCGCAATTGCTTATACGACAGCTATGCTCGAGTAA
TCGGAACCCGCTATTATGCAGATAATTCCAGTATATGCAG
GGCAGCAATCCATGCAGGGGTGATTCAAAGCGACTCAGGA
GGCTATGTGGACGTAATGCCTGTGGACAAGAGGAAGCAGC
ACAAGGGCTCCTACCAGAATGGCATCAGCTCAGAGAGCCT
ACAGAATCCCCCAGGAGGCAAAGCGTTCAGAGTGTTTGCG
GTCATTTGAAACCATTCTCCAAGGACGGATGCAAAGAAAT
AGAGCTCTTGGTAATGTTACAGCCGGTAATTACCACGCAT
TTGGTTTGCTGGTCGTGCTGGGCTAGATGTAAGGCCAGCG
CTGTCACGAAAAATCTCCTCTACAGGAAAATAAGACATTG
ACTTTGACACCATCTGCTCCTGAGAAAACTCCAGTCTCCT
TTTTTTATATCTGCATGTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations