Transcript

rcan1a-202

ID
ZDB-TSCRIPT-090929-10049
Name
rcan1a-202
Previous Names
  • rcan1a-002
  • zgc:100963-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027495 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027495|OTTDARG00000021578|ZDB-GENE-040801-135 rcan1a|OTTDARP00000022523 DKEY-67C22.1-002 LG_none CR548635.6,AL807829.21 Danio rerio protein_coding KNOWN, 814 bp
GAGAATAGAGCATTCCAGAAGATTCTGCCTCAGCTGAAGC
AGCATCACGTGACCACAATACGAGGACGTTACTCAACCTG
ACCCATTTCCTTTCTGAAAGCCCCGAAGGCTCTCTGCTGG
ATTGACAACGTCTGAGAGAAGGAGGAAGAAAAGGAGCAGT
GAAGAGGGTGTTTTTGAAGCATTTGTTTCCTGAAGCAGGC
GTCATTTGTGTCCTCACGCTGGGGAAGGCAAAACGGACAC
GTCTCAACCCCTCCTGCCCTTTACATTCTTTAACCTCTCA
AGTCCTCCGGAGGATCCGTCAACGGGCTTCAGTCATGCAC
CTGAAAACAATGAAGTGCAACCCTTTCTGCCTTATCGCTT
CCTTAGAGGATCCGGACATGTTTAACAGTCCTGTGGAGAT
GGCAGGATTTGAGGATCTTTTCCGTGCCTTTGACCGAAAT
GTCACTTTCCAGTTCTTCAAGAGTTTCCGTCGGGTGAGGA
TTAATTTCACCAATGCTTTGGCCGCTGCAGAGGCAAGAGC
AAAACTCCACAAAAGTGACTTCAATGGCAGAGAGTTACGA
CTCTATTTTGCACAGTCTGTCCACATTGGCAGTCCACACC
TGGAACCTCCTAAACCAGATAAACAGTTCCTCCTTTCCCC
TCCGCCATCACCTCCTGTGGGTTGGGAGCAGGCAAAAGAC
GCCACGCCCGTCATTAACTATGACCTCCTGTGTGCCATCG
CTAGACTAGGGCCAGGTGAAAAATATGAACTCCAACCAGG
AACTCCGACCACTCCAAGTGTGGTTGTTCATGTTTGTGAC
AATGATCAAGAAAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations