TALEN

TALEN3-epas1b

ID
ZDB-TALEN-180921-1
Name
TALEN3-epas1b
Previous Names
None
Target
Target Sequence 1
5' - TGTTTGTGCTGTATTGCAGGCT - 3'
Target Sequence 2
5' - TGAGTCTGTCTGCATCTGTCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This TALEN was designed based on sequence from the AB strain which differs from the TU strain used in Ensembl. ATGACAGATGGAGACAGACTCA - (sequence from AB), ATGACAGATGCAGACAGACTCA (sequence from Ensembl)
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
bns232 epas1b
Expression
Gene expression in Wild Types + TALEN3-epas1b
No data available
Phenotype
Phenotype resulting from TALEN3-epas1b
No data available
Phenotype of all Fish created by or utilizing TALEN3-epas1b
Phenotype Fish Conditions Figures
whole organism runx1 expression decreased amount, abnormal epas1abns231/bns231 ; epas1bbns232/bns232 standard conditions Fig. 4 from Gerri et al., 2018
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal epas1abns231/bns231 ; epas1bbns232/bns232 standard conditions Fig. 1 from Gerri et al., 2018
ventral wall of dorsal aorta myb expression decreased amount, abnormal epas1abns231/bns231 ; epas1bbns232/bns232 standard conditions Fig. 1 from Gerri et al., 2018
whole organism gata2b expression decreased amount, abnormal epas1abns231/bns231 ; epas1bbns232/bns232 control Fig. 5 from Gerri et al., 2018
hematopoietic progenitor cell differentiation decreased occurrence, abnormal epas1abns231/bns231 ; epas1bbns232/bns232 standard conditions Fig. 1 from Gerri et al., 2018
whole organism notch1a expression decreased amount, abnormal epas1abns231/bns231 ; epas1bbns232/bns232 control Fig. 5 from Gerri et al., 2018
whole organism notch1b expression decreased amount, abnormal epas1abns231/bns231 ; epas1bbns232/bns232 control Fig. 5 from Gerri et al., 2018
hematopoietic system myb expression decreased amount, abnormal epas1abns231/bns231 ; epas1bbns232/bns232 standard conditions Fig. 1 from Gerri et al., 2018
hematopoietic system runx1 expression decreased amount, abnormal epas1abns231/bns231 ; epas1bbns232/bns232 standard conditions Fig. 1 from Gerri et al., 2018
whole organism myb expression decreased amount, abnormal epas1abns231/bns231 ; epas1bbns232/bns232 standard conditions Fig. 4 from Gerri et al., 2018
hemopoiesis decreased occurrence, abnormal epas1abns231/bns231 ; epas1bbns232/bns232 standard conditions Fig. 1 from Gerri et al., 2018
Citations