TALEN

TALEN1-fdx1b

ID
ZDB-TALEN-160429-1
Name
TALEN1-fdx1b
Previous Names
None
Target
Target Sequence 1
5' - CTGGCCTGTTCCACC - 3'
ZFIN BLAST NCBI BLAST Ensembl
Target Sequence 2
5' - TTGTCAAACACATTCTCCTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
uob203 fdx1b
uob205 fdx1b
Expression
Gene expression in Wild Types + TALEN1-fdx1b
No data available
Phenotype
Phenotype resulting from TALEN1-fdx1b
No data available
Phenotype of all Fish created by or utilizing TALEN1-fdx1b
Phenotype Fish Conditions Figures
testis cyp11a1.2 expression increased amount, abnormal fdx1buob205/uob205 standard conditions Fig. 5 from Oakes et al., 2019
whole organism pck1 expression decreased amount, abnormal fdx1buob205/uob205 standard conditions Fig. 4 with image from Griffin et al., 2016
glutathione metabolic process process quality, abnormal fdx1buob205/uob205 control Fig. 4 from Weger et al., 2018
cortisol biosynthetic process disrupted, abnormal fdx1buob205/uob205 standard conditions Fig. 4 with image from Griffin et al., 2016
male organism cortisol decreased amount, abnormal fdx1buob205/uob205 standard conditions Fig. 3 from Oakes et al., 2019
whole organism gls2b expression decreased amount, abnormal fdx1buob205/uob205 control Fig. 3 from Weger et al., 2018
whole organism taurine decreased amount, abnormal fdx1buob205/uob205 control Fig. 4 from Weger et al., 2018
male organism increased weight, abnormal fdx1buob205/uob205 standard conditions text only from Oakes et al., 2019
whole organism gls2a expression increased amount, abnormal fdx1buob205/uob205 chemical treatment by environment: dexamethasone Fig. 3 from Weger et al., 2018
testis disorganized, abnormal fdx1buob205/uob205 standard conditions Fig. 6 from Oakes et al., 2019
whole organism guanosine 5'-monophosphate increased amount, abnormal fdx1buob205/uob205 control Fig. 5 from Weger et al., 2018
male organism fkbp5 expression decreased amount, abnormal fdx1buob205/uob205 standard conditions Fig. 4 from Oakes et al., 2019
whole organism duox expression amount, ameliorated fdx1buob205/uob205 chemical treatment by environment: dexamethasone Fig. S3 from Weger et al., 2018
testis cyp11c1 expression increased amount, abnormal fdx1buob205/uob205 standard conditions Fig. 5 from Oakes et al., 2019
male mating behavior decreased occurrence, abnormal fdx1buob205/uob205 standard conditions text only from Oakes et al., 2019
whole organism glutamine increased amount, abnormal fdx1buob205/uob205 control Fig. 3 from Weger et al., 2018
male organism 11beta-hydroxyandrost-4-ene-3,17-dione decreased amount, abnormal fdx1buob205/uob205 standard conditions Fig. 3 from Oakes et al., 2019
development of secondary male sexual characteristics decreased occurrence, abnormal fdx1buob205/uob205 standard conditions Fig. 2 from Oakes et al., 2019
female organism increased weight, abnormal fdx1buob205/uob205 standard conditions text only from Oakes et al., 2019
male organism pck1 expression decreased amount, abnormal fdx1buob205/uob205 standard conditions Fig. 4 from Oakes et al., 2019
male organism cyp2k22 expression decreased amount, abnormal fdx1buob205/uob205 standard conditions Fig. 4 from Oakes et al., 2019
interrenal gland increased size, abnormal fdx1buob205/uob205 standard conditions Fig. 6 with image from Weger et al., 2018
testis nanos2 expression increased amount, abnormal fdx1buob205/uob205 standard conditions Fig. 8 from Oakes et al., 2019
whole organism guanosine 5'-monophosphate amount, ameliorated fdx1buob205/uob205 chemical treatment by environment: dexamethasone Fig. 5 from Weger et al., 2018
whole organism fkbp5 expression decreased amount, abnormal fdx1buob205/uob205 isotonic Fig. 4 with image from Griffin et al., 2016
whole organism fth1a expression amount, ameliorated fdx1buob205/uob205 chemical treatment by environment: dexamethasone Fig. S3 from Weger et al., 2018
whole organism atic expression amount, ameliorated fdx1buob205/uob205 chemical treatment by environment: dexamethasone Fig. 5 from Weger et al., 2018
testis piwil1 expression increased amount, abnormal fdx1buob205/uob205 standard conditions Fig. 8 from Oakes et al., 2019
interrenal gland cyp17a2 expression increased distribution, abnormal fdx1buob205/uob205 standard conditions Fig. 6 with image from Weger et al., 2018
male organism 11-oxotestosterone decreased amount, abnormal fdx1buob205/uob205 standard conditions Fig. 3 from Oakes et al., 2019
whole organism pck1 expression decreased amount, abnormal fdx1buob205/uob205 isotonic Fig. 4 with image from Griffin et al., 2016
male organism androst-4-ene-3,17-dione increased amount, abnormal fdx1buob205/uob205 standard conditions Fig. 3 from Oakes et al., 2019
whole organism fkbp5 expression decreased amount, abnormal fdx1buob205/uob205 standard conditions Fig. 4 with image from Griffin et al., 2016
testis inha expression decreased amount, abnormal fdx1buob205/uob205 standard conditions Fig. 7 from Oakes et al., 2019
male organism 11beta-hydroxytestosterone decreased amount, abnormal fdx1buob205/uob205 standard conditions Fig. 3 from Oakes et al., 2019
testis sperm decreased concentration testis, abnormal fdx1buob205/uob205 standard conditions Fig. 6 from Oakes et al., 2019
male organism increased length, abnormal fdx1buob205/uob205 standard conditions text only from Oakes et al., 2019
whole organism duox expression increased amount, abnormal fdx1buob205/uob205 control Fig. S3 from Weger et al., 2018
interrenal gland hyperplastic, abnormal fdx1buob205/uob205 standard conditions Fig. 6 with image from Weger et al., 2018
whole organism atic expression increased amount, abnormal fdx1buob205/uob205 control Fig. 5 from Weger et al., 2018
whole organism gls2b expression increased amount, abnormal fdx1buob205/uob205 chemical treatment by environment: dexamethasone Fig. 3 from Weger et al., 2018
whole organism cysteine increased amount, abnormal fdx1buob205/uob205 control Fig. 4 from Weger et al., 2018
steroid biosynthetic process disrupted, abnormal fdx1buob205/uob205 standard conditions Fig. 5,  Fig. 6 from Griffin et al., 2016
whole organism alanine decreased amount, abnormal fdx1buob205/uob205 control Fig. 3 from Weger et al., 2018
testis igf3 expression decreased amount, abnormal fdx1buob205/uob205 standard conditions Fig. 7 from Oakes et al., 2019
whole organism paics expression increased amount, abnormal fdx1buob205/uob205 control Fig. 5 from Weger et al., 2018
whole organism ADP increased amount, abnormal fdx1buob205/uob205 control Fig. 5 from Weger et al., 2018
testis sox9a expression decreased amount, abnormal fdx1buob205/uob205 standard conditions Fig. 7 from Oakes et al., 2019
whole organism histidine decreased amount, abnormal fdx1buob205/uob205 control Fig. 3 from Weger et al., 2018
whole organism fth1a expression increased amount, abnormal fdx1buob205/uob205 control Fig. S3 from Weger et al., 2018
whole organism paics expression amount, ameliorated fdx1buob205/uob205 chemical treatment by environment: dexamethasone Fig. 5 from Weger et al., 2018
seminiferous tubule morphology, abnormal fdx1buob205/uob205 standard conditions Fig. 6 from Oakes et al., 2019
testis insl3 expression decreased amount, abnormal fdx1buob205/uob205 standard conditions Fig. 7 from Oakes et al., 2019
whole organism gls2a expression decreased amount, abnormal fdx1buob205/uob205 control Fig. 3 from Weger et al., 2018
whole organism pomca expression increased amount, abnormal fdx1buob205/uob205 isotonic Fig. 4 with image from Griffin et al., 2016
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.