ZFIN ID: ZDB-STS-050302-25
STS Name: zfish44906-4818b06.p1k
Sequence Ontology ID : SO:0000331
Synonym:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Location: Chr: 9 Details
Note: >gnl|ti|124617769 zfish44906-4818b06.p1k NAGAGGAGGCACTATCGATTCATTGGGTACGCCCGGTATTTTTTTGTTTGTTTTCAACTGAGCCACCTCT AAGAATCTCTTTCATTATTTTAGGCTGGCCTTTCAGAGGCTGAGCAGGAACAGATGAGAAAGATGCTTTA CCAGAAGGAATCCAATTACAATCGACTACGACGTGCCAAGATGGACAAATCAATGTTTGTCAAAATCAAG ACACTCGGCATTGGGGCCTTTGGTGAGGTGTGTCTAACCCGAAAAGTAGACACAGGAGCCTTGTATGCAA TGAAGACTTTGCGAAAGAAAGACGTTCTTAACCGAAATCAAGTAGCCCATGTTAAAGCTGAACGGGACAT TTTAGCAGAGGCTGACAATGAGTGGGTAGTCAGGTTGTACTATTCATTTCAAGACCGAGACAATCTGTAT TTTGTCATGGATTACATTCCTGGAGGAGATATGATGAGCTTGCTGATCCGTATGGGAGTTTTTCCAGAGG TCCTAGCCAGGTTTTATGTGGCAGAACTGACACTGGCAATTGAGAGTGTGCATAAGATGGGTTTCATCCA CAGAGATATCAAGCCAGACAACATCCTCATTGACCTGGATGGACACATCAAACTGACTGATTTTGGTCTA TGTACAGGGTTCCGATGGACTCACAACTCAAAGTATTACCAAAAAGGTAAGAGAAGGTGATGCTTATAGC CTTTAAAAAGTCCTTAATGCTGTTGCAGTGTTTACTAAATCCAATGAATTGGTTGCCTTCTCTCTCTGCA CTGCTTGAATAGGGAACCATATCCGACAGGATAGCATGGAGCCAAGTGACTTTTGGGATGATGTGTCTAA TTGCCGTTGTGGTGACCGGCTGATGACTTTGGAACAGATAGCAACTCCACAACACCAGCGCTGCCTGGCG CATTCTTTGGTGGCACCCCTATATACATTGCCCCTGAGGTGCTTTTGCGCCACGGTAGGAATATTCCCAT ACTCACTCGGAAGGACCAGGACCTTACATAGAATTGCTAGTGCCCATAGACCCTTTTTTTTTTAATTGCC CCTCTAATTATTCTAATACCCGGGTACCCC

{{control.fieldName}} Edit

ID: {{control.nomenID}}
{{control.fieldName}}:
Comments:

Attributions

{{pub.zdbID}}
MARKER RELATIONSHIPS
zfish44906-4818b06.p1k Is Encoded by: [Gene] lats2
SEQUENCE INFORMATION No data available
CITATIONS (1)