ZFIN ID: ZDB-SNP-060626-693
SNP Name: rs3729086
Previous Name: zsnp1624 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Variant Allele: A/T
Sequence:
TGCCTTGAGACACTTTATTGTTTAGTGTCTGGTTTTGACCATTCACACT
W
GCAACCTGATGGATTATTGTGTTATGAGTGCTTTGTTGAACTACTGCGTT
 (SNP highlighted)
W = A/T
Select Sequence Analysis Tool
Location: Chr: 21 Details
MARKER RELATIONSHIPS
rs3729086 Contained in: [Gene] pou5f3 (1)
Genome Resources: dbSNP:rs3729086 (1)
CITATIONS (2)