header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-SNP-060626-558
SNP Name: rs3727470
Previous Names: zsnp1501 (1), zsnp1993 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Variant Allele: A/T
Sequence:
ACACCCATTCCAGCTGTGTGTCCCCCTTTCACCGGCTCCACTAACCATACT
W
AAGCACTCGGGGTCCCGGTGAAGGAGGGCCATGCTTTTGACCACTGCAC
 (SNP highlighted)
W = A/T
Select Sequence Analysis Tool
Location: Chr: 7 Details
MARKER RELATIONSHIPS
rs3727470 Contained in: [Gene] aldh1a2 (1)
[EST] fb50h01 (1)
Genome Resources: dbSNP:rs3727470 (1)
CITATIONS (3)