header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-SNP-060626-501
SNP Name: rs3727619
Previous Name: zsnp145 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Variant Allele: C/T
Sequence:
CAGGAGAACAAATAGCATTTCCCATGAGGCCTTTGAGAGAGTAGGGAGC
Y
CCCATTTCCACCATAGTCTCCCCAAACACAGAGTTGGTATATNNNNNNNNN
 (SNP highlighted)
Y = C/T
Select Sequence Analysis Tool
Location: Chr: 2 Details
MARKER RELATIONSHIPS
rs3727619 Contained in: [EST] fj02a10 (1)
[Gene] ptgs2a (1)
OTHER rs3727619 SNP PAGES
  • dbSNP:rs3727619 (1)
  • CITATIONS (2)