ZFIN ID: ZDB-SNP-060626-242
SNP Name: rs3728680
Previous Name: zsnp1216 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Variant Allele: C/T
Sequence:
AACATCGTAAACAACATCACGACTCGATTTTAAGCCCTTTGCTTGGTCT
Y
GCAGGGCGTTTTGAGCTGTTTTGCTGCTGGAAGGATGTCAACACAAGGAAG
 (SNP highlighted)
Y = C/T
Select Sequence Analysis Tool
Location: Chr: 14 Details
MARKER RELATIONSHIPS
rs3728680 Contained in: [Gene] ccna2 (1)
[EST] fi36f03 (1)
Genome Resources: Ensembl_SNP:rs3728680 (1)
CITATIONS (2)