ZFIN ID: ZDB-SNP-060626-1609
SNP Name: rs3727536
Previous Name: zsnp62 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Variant Allele: C/T
Sequence:
CAAGCGCTGAGTTAATAGAGGTTCATAAACTTCATAAGGCCAAATTAAT
Y
TTTTTTTTTCAGTAATAGATTTCATAGGTCAAGCCGAAANNNNNNNNNNNN
 (SNP highlighted)
Y = C/T
Select Sequence Analysis Tool
Location: Unmapped
MARKER RELATIONSHIPS
rs3727536 Contained in: [Gene] anxa5b (1)
[EST] fj10f10 (1)
Genome Resources: Ensembl_SNP:rs3727536 (1)
CITATIONS (2)