ZFIN ID: ZDB-SNP-060626-1537
SNP Name: rs3728028
Previous Name: zsnp555 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Variant Allele: A/G
Sequence:
AATTTACACAATGGCTGTTGTTCCTTTTTAGATACAAGAGTATTTCGTC
R
ACTGAATCGGTTTTGGGTTGCCAAGTGAAAACATCTAGTCGTTGCTTCCTC
 (SNP highlighted)
R = A/G
Select Sequence Analysis Tool
Location: Chr: 7 Details
MARKER RELATIONSHIPS
rs3728028 Contained in: [EST] fc09c10 (1)
[Gene] pax6b (1)
Genome Resources: Ensembl_SNP:rs3728028 (1)
CITATIONS (2)