ZFIN ID: ZDB-SNP-060626-1536
SNP Name: rs3728027
Previous Name: zsnp554 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Variant Allele: A/T
Sequence:
NNGTTTTCATTCCTGTGACGTCACAATTATAAACGATCCATCACCAATT
W
ATATTCTCAGCTCCAAAACTTCATACATTGTCATAAAGTACTCGTTAATTT
 (SNP highlighted)
W = A/T
Select Sequence Analysis Tool
Location: Chr: 7 Details
MARKER RELATIONSHIPS
rs3728027 Contained in: [EST] fc09c10 (1)
[Gene] pax6b (1)
Genome Resources: Ensembl_SNP:rs3728027 (1)
CITATIONS (2)