header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-SNP-060626-1131
SNP Name: rs3727676
Previous Name: zsnp202 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Variant Allele: C/T
Sequence:
ACAGATTGCCAGCTCATTTGGATTTAGCAATACAATAGAACGGGGGTGC
Y
CCAACTCGGTCCTGGAGAGCTGGTGTCCTGCAGATTTTAGCTCCAACTTGA
 (SNP highlighted)
Y = C/T
Select Sequence Analysis Tool
Location: Unmapped
MARKER RELATIONSHIPS
rs3727676 Contained in: [EST] fb37f02 (1)
[Gene] unc45b
OTHER rs3727676 SNP PAGES
  • Ensembl_SNP:rs3727676 (1)
  • CITATIONS (2)