PUBLICATION
Corrigendum to "A novel nanoluciferase transgenic reporter measures proteinuria in zebrafish." Kidney Int. 2022;102:815-827
- Authors
- Naylor, R.W., Lemarie, E., Jackson-Crawford, A., Davenport, J.B., Mironov, A., Lowe, M., Lennon, R.
- ID
- ZDB-PUB-240107-9
- Date
- 2024
- Source
- Kidney International 105: 214215214-215 (Journal)
- Registered Authors
- Lennon, Rachel, Lowe, Martin, Naylor, Richard
- Keywords
- none
- MeSH Terms
- none
- PubMed
- 38182295 Full text @ Kidney Int.
Citation
Naylor, R.W., Lemarie, E., Jackson-Crawford, A., Davenport, J.B., Mironov, A., Lowe, M., Lennon, R. (2024) Corrigendum to "A novel nanoluciferase transgenic reporter measures proteinuria in zebrafish." Kidney Int. 2022;102:815-827. Kidney International. 105:214215214-215.
Abstract
The authors regret that the wrong sequence and concentration for the nphs2 morpholino were described in the original version of the manuscript. The sequence and concentration of the nphs2 morpholino have been corrected to TGCGATTTAAAACGTGTACCAGGGC and 1.0 mM, respectively, in the “Morpholino oligonucleotide treatments” portion of the Extended Supplementary Methods, where this information is described, and have been corrected in the article online. The data obtained with the morpholino (shown in Figure 3b of the main manuscript) are unchanged. The authors would like to apologize for any inconvenience caused.
Errata / Notes
This article corrects ZDB-PUB-220622-39.
Genes / Markers
Expression
Phenotype
Mutations / Transgenics
Human Disease / Model
Sequence Targeting Reagents
Fish
Orthology
Engineered Foreign Genes
Mapping