RETRACTED:Corrigendum to "Activation of hepatic stellate cells during liver carcinogenesis requires fibrinogen/ integrin αvβ5 in zebrafish" Neoplasia 20(5):533-542
- Authors
- Yan, C., Yang, Q., Gong, Z.
- ID
- ZDB-PUB-220930-13
- Date
- 2022
- Source
- Neoplasia (New York, N.Y.) 33: 100831 (Journal)
- Registered Authors
- Keywords
- none
- MeSH Terms
- none
- PubMed
- 36175045 Full text @ Neoplasia
The authors regret here for two errors in the published version of the manuscript.
The first error is gene annotation. For the PCR primers we used in the experiment (forward: AACCCACTCAACAGGACAGC; reverse: ACATTCACAGAACGGACCCC), we mistakenly annotated the gene as itgb5, where it should be itgb3a. Thus, throughout the manuscript where the gene name of itgb5 should be itgb3a instead. Consequently, integrin αvβ5 should be integrin αvβ3 throughout the manuscript. αvβ5 in the title of the manuscript should also be replaced with αvβ3.
The second error is Figure 1C. The authors accidentally placed two identical representative images for Caspase 3 staining side by side. Specifically, representative image for Caspase 3 stained for WT zebrafish larvae was mistakenly duplicated from the kras+ group. As indicated by the quantification data, the WT group should have lower positive staining. Despite the error in presentation of the representative image, the integrity of the experiment including statistical analyses remains valid.
The authors would like to apologise for any inconvenience caused.