CORRECTION: SoxF factors induce Notch1 expression via direct transcriptional regulation during early arterial development.

There were errors published in ‘SoxF factors induce Notch1 expression via direct transcriptional regulation during early arterial development’ by Ivy Kim-Ni Chiang, Martin Fritzsche, Cathy Pichol-Thievend, Alice Neal, Kelly Holmes, Anne Lagendijk, Jeroen Overman, Donatella D'Angelo, Alice Omini, Dorien Hermkens, Emmanuelle Lesieur, Ke Liu, Indrika Ratnayaka, Monica Corada, George Bou-Gharios, Jason Carroll, Elisabetta Dejana, Stefan Schulte-Merker, Benjamin Hogan, Monica Beltrame, Sarah De Val and Mathias Francois (2017). Development 144, 2629-2639 (doi: 10.1242/dev.146241).
The contribution of Nicolas Fossat, Tania Radziewic and Patrick P. L. Tam was inadvertently omitted. These authors generated and validated the Sox7 knockout mouse line used to produce the Sox7/Sox18 double-knockout line (Fig. 9A). An explanation of how this mouse line was generated was absent from the supplementary Materials and Methods. In addition, the middle initial of Benjamin Hogan was missing.
The corrected author list and affiliations appear above. Revised Author contributions and Funding sections, as well as a revised section of the supplementary Materials and Methods that now includes generation of the Sox7 knockout mouse line, appear below.
The authors apologise to readers for these mistakes.
Supplementary Materials and Methods
Generation and analysis of transgenic and mutant mice (final paragraph)
Sox7:tm1 (Sox7+/−) mice were generated through germline transmission in chimaeras, using VGB6 ES cells (of C57BL/6NTac background) that contained an inactivated Sox7 allele replaced with a ZEN-Ub1 cassette from Velocigene (Sox7tm1(KOMP)Vlcg), and obtained from the KOMP repository at University of California at Davis (https://www.komp.org/pdf.php?projectID=VG10649). Compound Sox7−/−;Sox18−/− mouse embryos were generated on the C57BL/6 background through crossing heterozygous Sox7:tm1 to Sox18:tm1, generating Sox7+/−;Sox18+/− mice which were subsequently incrossed (Pennisi et al., 2000a). Genotype was confirmed by PCR using the following primers: mSox7(F), TGTAACTTGGAGATCCATAGAGC; mSox7(R), TCATTCTCAGTATTGTTTTGCC; mSox7lacZ(R), TGGATCAGCTAAGCCAGGT; mSox18(F), CCCGACGTCCATCAGACCTC; mSox18(R), GTCGCTTGCGCTCGTCCTTC; mSox18lacZ(R), CGCCCGTTGCACCACAGATG. All animals used were 7-24 weeks old.