Morpholino

MO2-klhl13

ID
ZDB-MRPHLNO-260422-1
Name
MO2-klhl13
Previous Names
None
Target
Sequence
5' - TCTATGCACAGGGTGGTCCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Author was contacted and provided this corrected sequence.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-klhl13
No data available
Phenotype
Phenotype resulting from MO2-klhl13
Phenotype of all Fish created by or utilizing MO2-klhl13
Phenotype Fish Conditions Figures
whole organism Ab2-aurkb labeling increased amount, abnormal AB/TU + MO2-klhl13 + MO4-tp53 control Fig. 5 with image from Akhter et al., 2025
swim bladder absence of anatomical entity, abnormal AB/TU + MO2-klhl13 + MO4-tp53 control Fig. 4 with image,  Fig. 5 with image from Akhter et al., 2025
post-vent region kinked, abnormal AB/TU + MO2-klhl13 + MO4-tp53 control Fig. 4 with image,  Fig. 5 with image from Akhter et al., 2025
pericardium edematous, abnormal AB/TU + MO2-klhl13 + MO4-tp53 control Fig. 4 with image,  Fig. 5 with image from Akhter et al., 2025
pericardium composition, ameliorated AB/TU + MO2-klhl13 + MO4-tp53 chemical treatment by environment: AZD-1152 Fig. 5 with image from Akhter et al., 2025
swimming behavior decreased process quality, abnormal AB/TU + MO2-klhl13 + MO4-tp53 lighting conditions Fig. 4 with image from Akhter et al., 2025
ventral mandibular arch physical quality, ameliorated AB/TU + MO2-klhl13 + MO4-tp53 chemical treatment by environment: AZD-1152 Fig. 5 with image from Akhter et al., 2025
ball composition, ameliorated AB/TU + MO2-klhl13 + MO4-tp53 chemical treatment by environment: AZD-1152 Fig. 5 with image from Akhter et al., 2025
ventral mandibular arch protruding, abnormal AB/TU + MO2-klhl13 + MO4-tp53 control Fig. 4 with image,  Fig. 5 with image from Akhter et al., 2025
post-vent region curvature, ameliorated AB/TU + MO2-klhl13 + MO4-tp53 chemical treatment by environment: AZD-1152 Fig. 5 with image from Akhter et al., 2025
ball edematous, abnormal AB/TU + MO2-klhl13 + MO4-tp53 control Fig. 4 with image,  Fig. 5 with image from Akhter et al., 2025
swimming behavior decreased process quality, abnormal AB/TU + MO2-klhl13 + MO4-tp53 lighting conditions Fig. 4 with image from Akhter et al., 2025
optic tectum EGFP expression spatial pattern, ameliorated AB/TU + MO2-klhl13 + MO4-tp53 chemical treatment by environment: AZD-1152 Fig. 5 with image from Akhter et al., 2025
post-vent region curved, abnormal AB/TU + MO2-klhl13 + MO4-tp53 control Fig. 4 with image,  Fig. 5 with image from Akhter et al., 2025
swimming behavior decreased process quality, abnormal AB/TU + MO2-klhl13 + MO4-tp53 control Fig. 5 with image from Akhter et al., 2025
whole organism length, ameliorated AB/TU + MO2-klhl13 + MO4-tp53 chemical treatment by environment: AZD-1152 Fig. 5 with image from Akhter et al., 2025
swimming behavior process quality, ameliorated AB/TU + MO2-klhl13 + MO4-tp53 chemical treatment by environment: AZD-1152 Fig. 5 with image from Akhter et al., 2025
whole organism decreased length, abnormal AB/TU + MO2-klhl13 + MO4-tp53 control Fig. 4 with image,  Fig. 5 with image from Akhter et al., 2025
swim bladder amount, ameliorated AB/TU + MO2-klhl13 + MO4-tp53 chemical treatment by environment: AZD-1152 Fig. 5 with image from Akhter et al., 2025
optic tectum area, ameliorated nl1Tg + MO2-klhl13 + MO4-tp53 (AB/TU) chemical treatment by environment: AZD-1152 Fig. 5 with image from Akhter et al., 2025
optic tectum increased area, abnormal nl1Tg + MO2-klhl13 + MO4-tp53 (AB/TU) control Fig. 4 with image,  Fig. 5 with image from Akhter et al., 2025
optic tectum EGFP expression increased distribution, abnormal nl1Tg + MO2-klhl13 + MO4-tp53 (AB/TU) control Fig. 4 with image,  Fig. 5 with image from Akhter et al., 2025
Citations