Morpholino

MO2-slc33a2

ID
ZDB-MRPHLNO-251107-2
Name
MO2-slc33a2
Previous Names
  • mfsd3-E2I2 (1)
Target
Sequence
5' - ACAACAAAACACACTCCCTACCTGT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-slc33a2
No data available
Phenotype
Phenotype resulting from MO2-slc33a2
Phenotype Fish Figures
head neuromast hair cell decreased amount, abnormal s356tTg + MO2-slc33a2 (AB) FIGURE 1 with image from Ma et al., 2025
head neuromast hair cell GFP expression decreased distribution, abnormal s356tTg + MO2-slc33a2 (AB) FIGURE 1 with image from Ma et al., 2025
otic vesicle decreased area, abnormal s356tTg + MO2-slc33a2 (AB) FIGURE 1 with image from Ma et al., 2025
otic vesicle decreased size, abnormal s356tTg + MO2-slc33a2 (AB) FIGURE 1 with image from Ma et al., 2025
otic vesicle hair cell decreased amount, abnormal s356tTg + MO2-slc33a2 (AB) FIGURE 1 with image from Ma et al., 2025
otic vesicle hair cell GFP expression decreased distribution, abnormal s356tTg + MO2-slc33a2 (AB) FIGURE 1 with image from Ma et al., 2025
otolith decreased area, abnormal s356tTg + MO2-slc33a2 (AB) FIGURE 1 with image from Ma et al., 2025
otolith decreased diameter, abnormal s356tTg + MO2-slc33a2 (AB) FIGURE 1 with image from Ma et al., 2025
otolith decreased size, abnormal s356tTg + MO2-slc33a2 (AB) FIGURE 1 with image from Ma et al., 2025
pericardium edematous, abnormal s356tTg + MO2-slc33a2 (AB) FIGURE 2 with image from Ma et al., 2025
post-vent region curved, abnormal s356tTg + MO2-slc33a2 (AB) FIGURE 2 with image from Ma et al., 2025
posterior lateral line hair cell decreased amount, abnormal s356tTg + MO2-slc33a2 (AB) FIGURE 1 with imageFIGURE 2 with image from Ma et al., 2025
posterior lateral line hair cell GFP expression decreased distribution, abnormal s356tTg + MO2-slc33a2 (AB) FIGURE 2 with image from Ma et al., 2025
swimming behavior decreased process quality, abnormal s356tTg + MO2-slc33a2 (AB) FIGURE 3 with image from Ma et al., 2025
whole organism decreased length, abnormal s356tTg + MO2-slc33a2 (AB) FIGURE 2 with image from Ma et al., 2025
whole organism fzd7b expression increased amount, abnormal s356tTg + MO2-slc33a2 (AB) FIGURE 4 with image from Ma et al., 2025
whole organism fzd7a expression increased amount, abnormal s356tTg + MO2-slc33a2 (AB) FIGURE 4 with image from Ma et al., 2025
whole organism wnt9a expression increased amount, abnormal s356tTg + MO2-slc33a2 (AB) FIGURE 4 with image from Ma et al., 2025
whole organism lef1 expression increased amount, abnormal s356tTg + MO2-slc33a2 (AB) FIGURE 4 with image from Ma et al., 2025
whole organism lrp5 expression increased amount, abnormal s356tTg + MO2-slc33a2 (AB) FIGURE 4 with image from Ma et al., 2025
whole organism wnt8a expression increased amount, abnormal s356tTg + MO2-slc33a2 (AB) FIGURE 4 with image from Ma et al., 2025
whole organism lrp6 expression increased amount, abnormal s356tTg + MO2-slc33a2 (AB) FIGURE 4 with image from Ma et al., 2025
whole organism mycn expression increased amount, abnormal s356tTg + MO2-slc33a2 (AB) FIGURE 4 with image from Ma et al., 2025
whole organism ctnnb1 expression increased amount, abnormal s356tTg + MO2-slc33a2 (AB) FIGURE 4 with image from Ma et al., 2025
whole organism axin1 expression increased amount, abnormal s356tTg + MO2-slc33a2 (AB) FIGURE 4 with image from Ma et al., 2025
whole organism axin2 expression increased amount, abnormal s356tTg + MO2-slc33a2 (AB) FIGURE 4 with image from Ma et al., 2025
whole organism gsk3ba expression increased amount, abnormal s356tTg + MO2-slc33a2 (AB) FIGURE 4 with image from Ma et al., 2025
whole organism dkk1b expression increased amount, abnormal s356tTg + MO2-slc33a2 (AB) FIGURE 4 with image from Ma et al., 2025
whole organism frzb expression increased amount, abnormal s356tTg + MO2-slc33a2 (AB) FIGURE 4 with image from Ma et al., 2025
whole organism myca expression increased amount, abnormal s356tTg + MO2-slc33a2 (AB) FIGURE 4 with image from Ma et al., 2025
whole organism viability, abnormal s356tTg + MO2-slc33a2 (AB) FIGURE 2 with image from Ma et al., 2025
Phenotype of all Fish created by or utilizing MO2-slc33a2
Phenotype Fish Conditions Figures
otic vesicle decreased size, abnormal s356tTg + MO2-slc33a2 (AB) control FIGURE 1 with image from Ma et al., 2025
whole organism viability, abnormal s356tTg + MO2-slc33a2 (AB) control FIGURE 2 with image from Ma et al., 2025
whole organism gsk3ba expression increased amount, abnormal s356tTg + MO2-slc33a2 (AB) control FIGURE 4 with image from Ma et al., 2025
posterior lateral line hair cell decreased amount, abnormal s356tTg + MO2-slc33a2 (AB) control FIGURE 1 with imageFIGURE 2 with image from Ma et al., 2025
whole organism decreased length, abnormal s356tTg + MO2-slc33a2 (AB) control FIGURE 2 with image from Ma et al., 2025
head neuromast hair cell decreased amount, abnormal s356tTg + MO2-slc33a2 (AB) control FIGURE 1 with image from Ma et al., 2025
otolith decreased size, abnormal s356tTg + MO2-slc33a2 (AB) control FIGURE 1 with image from Ma et al., 2025
whole organism fzd7a expression increased amount, abnormal s356tTg + MO2-slc33a2 (AB) control FIGURE 4 with image from Ma et al., 2025
swimming behavior decreased process quality, abnormal s356tTg + MO2-slc33a2 (AB) control FIGURE 3 with image from Ma et al., 2025
whole organism ctnnb1 expression increased amount, abnormal s356tTg + MO2-slc33a2 (AB) control FIGURE 4 with image from Ma et al., 2025
whole organism lef1 expression increased amount, abnormal s356tTg + MO2-slc33a2 (AB) control FIGURE 4 with image from Ma et al., 2025
otic vesicle hair cell decreased amount, abnormal s356tTg + MO2-slc33a2 (AB) control FIGURE 1 with image from Ma et al., 2025
otic vesicle hair cell GFP expression decreased distribution, abnormal s356tTg + MO2-slc33a2 (AB) control FIGURE 1 with image from Ma et al., 2025
whole organism fzd7b expression increased amount, abnormal s356tTg + MO2-slc33a2 (AB) control FIGURE 4 with image from Ma et al., 2025
whole organism lrp6 expression increased amount, abnormal s356tTg + MO2-slc33a2 (AB) control FIGURE 4 with image from Ma et al., 2025
whole organism axin1 expression increased amount, abnormal s356tTg + MO2-slc33a2 (AB) control FIGURE 4 with image from Ma et al., 2025
otic vesicle decreased area, abnormal s356tTg + MO2-slc33a2 (AB) control FIGURE 1 with image from Ma et al., 2025
whole organism lrp5 expression increased amount, abnormal s356tTg + MO2-slc33a2 (AB) control FIGURE 4 with image from Ma et al., 2025
posterior lateral line hair cell GFP expression decreased distribution, abnormal s356tTg + MO2-slc33a2 (AB) control FIGURE 2 with image from Ma et al., 2025
whole organism wnt9a expression increased amount, abnormal s356tTg + MO2-slc33a2 (AB) control FIGURE 4 with image from Ma et al., 2025
otolith decreased diameter, abnormal s356tTg + MO2-slc33a2 (AB) control FIGURE 1 with image from Ma et al., 2025
whole organism dkk1b expression increased amount, abnormal s356tTg + MO2-slc33a2 (AB) control FIGURE 4 with image from Ma et al., 2025
whole organism mycn expression increased amount, abnormal s356tTg + MO2-slc33a2 (AB) control FIGURE 4 with image from Ma et al., 2025
whole organism axin2 expression increased amount, abnormal s356tTg + MO2-slc33a2 (AB) control FIGURE 4 with image from Ma et al., 2025
whole organism myca expression increased amount, abnormal s356tTg + MO2-slc33a2 (AB) control FIGURE 4 with image from Ma et al., 2025
whole organism frzb expression increased amount, abnormal s356tTg + MO2-slc33a2 (AB) control FIGURE 4 with image from Ma et al., 2025
otolith decreased area, abnormal s356tTg + MO2-slc33a2 (AB) control FIGURE 1 with image from Ma et al., 2025
whole organism wnt8a expression increased amount, abnormal s356tTg + MO2-slc33a2 (AB) control FIGURE 4 with image from Ma et al., 2025
post-vent region curved, abnormal s356tTg + MO2-slc33a2 (AB) control FIGURE 2 with image from Ma et al., 2025
head neuromast hair cell GFP expression decreased distribution, abnormal s356tTg + MO2-slc33a2 (AB) control FIGURE 1 with image from Ma et al., 2025
pericardium edematous, abnormal s356tTg + MO2-slc33a2 (AB) control FIGURE 2 with image from Ma et al., 2025
Citations