Morpholino

MO1-slc33a2

ID
ZDB-MRPHLNO-251107-1
Name
MO1-slc33a2
Previous Names
None
Target
Sequence
5' - GAACACCAGCTTGTCGTTCATCATG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-slc33a2
No data available
Phenotype
Phenotype resulting from MO1-slc33a2
Phenotype Fish Figures
head neuromast hair cell decreased amount, abnormal s356tTg + MO1-slc33a2 (AB) FIGURE 1 with image from Ma et al., 2025
head neuromast hair cell GFP expression decreased distribution, abnormal s356tTg + MO1-slc33a2 (AB) FIGURE 1 with image from Ma et al., 2025
otic vesicle decreased area, abnormal s356tTg + MO1-slc33a2 (AB) FIGURE 1 with image from Ma et al., 2025
otic vesicle decreased size, abnormal s356tTg + MO1-slc33a2 (AB) FIGURE 1 with image from Ma et al., 2025
otic vesicle hair cell decreased amount, abnormal s356tTg + MO1-slc33a2 (AB) FIGURE 1 with image from Ma et al., 2025
otic vesicle hair cell GFP expression decreased distribution, abnormal s356tTg + MO1-slc33a2 (AB) FIGURE 1 with image from Ma et al., 2025
otolith decreased area, abnormal s356tTg + MO1-slc33a2 (AB) FIGURE 1 with image from Ma et al., 2025
otolith decreased diameter, abnormal s356tTg + MO1-slc33a2 (AB) FIGURE 1 with image from Ma et al., 2025
otolith decreased size, abnormal s356tTg + MO1-slc33a2 (AB) FIGURE 1 with image from Ma et al., 2025
pericardium edematous, abnormal s356tTg + MO1-slc33a2 (AB) FIGURE 2 with image from Ma et al., 2025
post-vent region curved, abnormal s356tTg + MO1-slc33a2 (AB) FIGURE 2 with image from Ma et al., 2025
posterior lateral line hair cell decreased amount, abnormal s356tTg + MO1-slc33a2 (AB) FIGURE 1 with image,  FIGURE 2 with image from Ma et al., 2025
posterior lateral line hair cell GFP expression decreased distribution, abnormal s356tTg + MO1-slc33a2 (AB) FIGURE 2 with image from Ma et al., 2025
swimming behavior decreased process quality, abnormal s356tTg + MO1-slc33a2 (AB) FIGURE 3 with image from Ma et al., 2025
whole organism decreased length, abnormal s356tTg + MO1-slc33a2 (AB) FIGURE 2 with image from Ma et al., 2025
whole organism viability, abnormal s356tTg + MO1-slc33a2 (AB) FIGURE 2 with image from Ma et al., 2025
Phenotype of all Fish created by or utilizing MO1-slc33a2
Phenotype Fish Conditions Figures
whole organism viability, abnormal s356tTg + MO1-slc33a2 (AB) control FIGURE 2 with image from Ma et al., 2025
posterior lateral line hair cell decreased amount, abnormal s356tTg + MO1-slc33a2 (AB) control FIGURE 1 with image,  FIGURE 2 with image from Ma et al., 2025
otic vesicle decreased area, abnormal s356tTg + MO1-slc33a2 (AB) control FIGURE 1 with image from Ma et al., 2025
head neuromast hair cell decreased amount, abnormal s356tTg + MO1-slc33a2 (AB) control FIGURE 1 with image from Ma et al., 2025
otolith decreased size, abnormal s356tTg + MO1-slc33a2 (AB) control FIGURE 1 with image from Ma et al., 2025
otolith decreased diameter, abnormal s356tTg + MO1-slc33a2 (AB) control FIGURE 1 with image from Ma et al., 2025
swimming behavior decreased process quality, abnormal s356tTg + MO1-slc33a2 (AB) control FIGURE 3 with image from Ma et al., 2025
otic vesicle hair cell decreased amount, abnormal s356tTg + MO1-slc33a2 (AB) control FIGURE 1 with image from Ma et al., 2025
whole organism decreased length, abnormal s356tTg + MO1-slc33a2 (AB) control FIGURE 2 with image from Ma et al., 2025
posterior lateral line hair cell GFP expression decreased distribution, abnormal s356tTg + MO1-slc33a2 (AB) control FIGURE 2 with image from Ma et al., 2025
head neuromast hair cell GFP expression decreased distribution, abnormal s356tTg + MO1-slc33a2 (AB) control FIGURE 1 with image from Ma et al., 2025
otic vesicle hair cell GFP expression decreased distribution, abnormal s356tTg + MO1-slc33a2 (AB) control FIGURE 1 with image from Ma et al., 2025
post-vent region curved, abnormal s356tTg + MO1-slc33a2 (AB) control FIGURE 2 with image from Ma et al., 2025
otolith decreased area, abnormal s356tTg + MO1-slc33a2 (AB) control FIGURE 1 with image from Ma et al., 2025
pericardium edematous, abnormal s356tTg + MO1-slc33a2 (AB) control FIGURE 2 with image from Ma et al., 2025
otic vesicle decreased size, abnormal s356tTg + MO1-slc33a2 (AB) control FIGURE 1 with image from Ma et al., 2025
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.