Morpholino

MO1-opn3

ID
ZDB-MRPHLNO-250721-1
Name
MO1-opn3
Previous Names
None
Target
Sequence
5' - AAGACATGGACTTACCATTTTAACT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-opn3
No data available
Phenotype
Phenotype resulting from MO1-opn3
Phenotype of all Fish created by or utilizing MO1-opn3
Phenotype Fish Conditions Figures
intersegmental vein absence of anatomical entity, abnormal is5Tg + MO1-opn3 control Fig. 8 with image from Luo et al., 2025
brain vasculature decreased distribution, abnormal is5Tg + MO1-opn3 control Fig. 8 with image from Luo et al., 2025
intersegmental vein structurally discontinuous, abnormal is5Tg + MO1-opn3 control Fig. 8 with image from Luo et al., 2025
dorsal longitudinal anastomotic vessel absence of anatomical entity, abnormal is5Tg + MO1-opn3 control Fig. 8 with image from Luo et al., 2025
intersegmental vein decreased length, abnormal y1Tg + MO1-opn3 control Fig. 7 with imageFig. 8 with image from Luo et al., 2025
whole organism ab5-akt labeling amount, ameliorated y1Tg + MO1-opn3 chemical treatment by injection: SC79 Fig. 8 with image from Luo et al., 2025
intersegmental vein morphology, ameliorated y1Tg + MO1-opn3 chemical treatment by injection: SC79 Fig. 8 with image from Luo et al., 2025
dorsal longitudinal anastomotic vessel absence of anatomical entity, abnormal y1Tg + MO1-opn3 control Fig. 7 with imageFig. 8 with image from Luo et al., 2025
intersegmental vein structurally discontinuous, abnormal y1Tg + MO1-opn3 control Fig. 7 with imageFig. 8 with image from Luo et al., 2025
intersegmental vein absence of anatomical entity, abnormal y1Tg + MO1-opn3 control Fig. 8 with image from Luo et al., 2025
dorsal longitudinal anastomotic vessel morphology, ameliorated y1Tg + MO1-opn3 chemical treatment by injection: SC79 Fig. 8 with image from Luo et al., 2025
whole organism Ab1-opn3 labeling decreased amount, abnormal y1Tg + MO1-opn3 control Fig. 7 with imageFig. 8 with image from Luo et al., 2025
whole organism Ab6-kdrl labeling decreased amount, abnormal y1Tg + MO1-opn3 control Fig. 8 with image from Luo et al., 2025
intersegmental vein decreased thickness, abnormal y1Tg + MO1-opn3 control Fig. 7 with image from Luo et al., 2025
whole organism ab5-akt labeling decreased amount, abnormal y1Tg + MO1-opn3 control Fig. 8 with image from Luo et al., 2025
brain vasculature decreased distribution, abnormal y1Tg + MO1-opn3 control Fig. 8 with image from Luo et al., 2025
brain vasculature spatial pattern, ameliorated y1Tg + MO1-opn3 chemical treatment by injection: SC79 Fig. 8 with image from Luo et al., 2025
Citations