Morpholino

MO2-glulb

ID
ZDB-MRPHLNO-250403-1
Name
MO2-glulb
Previous Names
None
Target
Sequence
5' - ACCTGTTAGGATAGAAATGGAGTTT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-glulb
No data available
Phenotype
Phenotype resulting from MO2-glulb
Phenotype Fish Figures
anterior crista hair cell decreased amount, abnormal s356tTg + MO2-glulb (AB) Figure 4 with imageFigure 5 with image from Zhao et al., 2024
anterior crista hair cell GFP expression decreased distribution, abnormal s356tTg + MO2-glulb (AB) Figure 4 with imageFigure 5 with image from Zhao et al., 2024
lateral crista hair cell decreased amount, abnormal s356tTg + MO2-glulb (AB) Figure 4 with imageFigure 5 with image from Zhao et al., 2024
lateral crista hair cell GFP expression decreased distribution, abnormal s356tTg + MO2-glulb (AB) Figure 4 with imageFigure 5 with image from Zhao et al., 2024
neuromast decreased amount, abnormal sqet10Et + MO2-glulb (AB) Figure 4 with image from Zhao et al., 2024
neuromast GFP expression decreased distribution, abnormal s356tTg + MO2-glulb (AB) Figure 4 with image from Zhao et al., 2024
neuromast EGFP expression decreased distribution, abnormal sqet10Et + MO2-glulb (AB) Figure 4 with image from Zhao et al., 2024
neuromast eya1 expression decreased distribution, abnormal AB + MO2-glulb Figure 4 with image from Zhao et al., 2024
neuromast hair cell decreased amount, abnormal s356tTg + MO2-glulb (AB) Figure 4 with imageFigure 5 with image from Zhao et al., 2024
neuromast hair cell GFP expression decreased distribution, abnormal s356tTg + MO2-glulb (AB) Figure 5 with image from Zhao et al., 2024
neuromast hair cell apoptotic process increased process quality, abnormal s356tTg + MO2-glulb (AB) Figure 5 with image from Zhao et al., 2024
posterior crista hair cell decreased amount, abnormal s356tTg + MO2-glulb (AB) Figure 4 with imageFigure 5 with image from Zhao et al., 2024
posterior crista hair cell GFP expression decreased distribution, abnormal s356tTg + MO2-glulb (AB) Figure 4 with imageFigure 5 with image from Zhao et al., 2024
Phenotype of all Fish created by or utilizing MO2-glulb
Phenotype Fish Conditions Figures
neuromast decreased amount, abnormal AB + MO2-glulb control Figure 4 with image from Zhao et al., 2024
neuromast eya1 expression decreased distribution, abnormal AB + MO2-glulb control Figure 4 with image from Zhao et al., 2024
swimming behavior decreased process quality, abnormal AB + MO2-glulb acoustic radiation Figure 3 with image from Zhao et al., 2024
swimming behavior decreased process quality, abnormal AB + MO2-glulb vibration Figure 3 with image from Zhao et al., 2024
neuromast hair cell decreased amount, abnormal s356tTg + MO2-glulb (AB) chemical treatment by environment: glutamine Figure 5 with image from Zhao et al., 2024
posterior crista hair cell decreased amount, abnormal s356tTg + MO2-glulb (AB) chemical treatment by environment: glutamine Figure 5 with image from Zhao et al., 2024
anterior crista hair cell decreased amount, abnormal s356tTg + MO2-glulb (AB) chemical treatment by environment: glutamine Figure 5 with image from Zhao et al., 2024
anterior crista hair cell GFP expression decreased distribution, abnormal s356tTg + MO2-glulb (AB) chemical treatment by environment: glutamine Figure 5 with image from Zhao et al., 2024
posterior crista hair cell GFP expression decreased distribution, abnormal s356tTg + MO2-glulb (AB) control Figure 4 with imageFigure 5 with image from Zhao et al., 2024
lateral crista hair cell decreased amount, abnormal s356tTg + MO2-glulb (AB) control Figure 4 with imageFigure 5 with image from Zhao et al., 2024
posterior crista hair cell GFP expression decreased distribution, abnormal s356tTg + MO2-glulb (AB) chemical treatment by environment: glutamine Figure 5 with image from Zhao et al., 2024
neuromast hair cell decreased amount, abnormal s356tTg + MO2-glulb (AB) control Figure 4 with imageFigure 5 with image from Zhao et al., 2024
neuromast hair cell GFP expression decreased distribution, abnormal s356tTg + MO2-glulb (AB) control Figure 5 with image from Zhao et al., 2024
anterior crista hair cell decreased amount, abnormal s356tTg + MO2-glulb (AB) control Figure 4 with imageFigure 5 with image from Zhao et al., 2024
neuromast GFP expression decreased distribution, abnormal s356tTg + MO2-glulb (AB) control Figure 4 with image from Zhao et al., 2024
posterior crista hair cell decreased amount, abnormal s356tTg + MO2-glulb (AB) control Figure 4 with imageFigure 5 with image from Zhao et al., 2024
neuromast hair cell apoptotic process increased process quality, abnormal s356tTg + MO2-glulb (AB) control Figure 5 with image from Zhao et al., 2024
lateral crista hair cell GFP expression decreased distribution, abnormal s356tTg + MO2-glulb (AB) control Figure 4 with imageFigure 5 with image from Zhao et al., 2024
lateral crista hair cell GFP expression decreased distribution, abnormal s356tTg + MO2-glulb (AB) chemical treatment by environment: glutamine Figure 5 with image from Zhao et al., 2024
neuromast hair cell GFP expression decreased distribution, abnormal s356tTg + MO2-glulb (AB) chemical treatment by environment: glutamine Figure 5 with image from Zhao et al., 2024
anterior crista hair cell GFP expression decreased distribution, abnormal s356tTg + MO2-glulb (AB) control Figure 4 with imageFigure 5 with image from Zhao et al., 2024
lateral crista hair cell decreased amount, abnormal s356tTg + MO2-glulb (AB) chemical treatment by environment: glutamine Figure 5 with image from Zhao et al., 2024
neuromast decreased amount, abnormal sqet10Et + MO2-glulb (AB) control Figure 4 with image from Zhao et al., 2024
neuromast EGFP expression decreased distribution, abnormal sqet10Et + MO2-glulb (AB) control Figure 4 with image from Zhao et al., 2024
Citations