Morpholino

MO1-dnm1a

ID
ZDB-MRPHLNO-240711-3
Name
MO1-dnm1a
Previous Names
None
Target
Sequence
5' - CGCCGGAGAAACTGCGCTTTATTGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-dnm1a
No data available
Phenotype
Phenotype resulting from MO1-dnm1a
Phenotype Fish Figures
CaP motoneuron axon ab1-tuba labeling spatial pattern, abnormal AB + MO1-dnm1a + MO4-tp53 Fig. 4 with image from Bragato et al., 2023
CaP motoneuron neuron projection decreased branchiness, abnormal AB + MO1-dnm1a + MO4-tp53 Fig. 4 with image from Bragato et al., 2023
CaP motoneuron neuron projection decreased distribution, abnormal AB + MO1-dnm1a + MO4-tp53 Fig. 4 with image from Bragato et al., 2023
muscle cell atrophied, abnormal AB + MO1-dnm1a + MO4-tp53 Fig. 5 with image from Bragato et al., 2023
muscle cell decreased amount, abnormal AB + MO1-dnm1a + MO4-tp53 Fig. 5 with image from Bragato et al., 2023
muscle cell disorganized, abnormal AB + MO1-dnm1a + MO4-tp53 Fig. 5 with image from Bragato et al., 2023
muscle cell increased distance muscle cell, abnormal AB + MO1-dnm1a + MO4-tp53 Fig. 5 with image from Bragato et al., 2023
muscle cell vacuole increased amount, abnormal AB + MO1-dnm1a + MO4-tp53 Fig. 5 with image from Bragato et al., 2023
myotome skeletal muscle myoblast increased amount, abnormal AB + MO1-dnm1a + MO4-tp53 Fig. 5 with image from Bragato et al., 2023
post-vent region curved, abnormal AB + MO1-dnm1a + MO4-tp53 Fig. 3 with image from Bragato et al., 2023
slow muscle cell spatial pattern, abnormal AB + MO1-dnm1a + MO4-tp53 Fig. 5 with image from Bragato et al., 2023
somite C-shaped, abnormal AB + MO1-dnm1a + MO4-tp53 Fig. 3 with image from Bragato et al., 2023
thigmotaxis process characteristic, abnormal AB + MO1-dnm1a + MO4-tp53 Table 2 from Bragato et al., 2023
whole organism Ab-dnm1 labeling decreased amount, abnormal AB + MO1-dnm1a + MO4-tp53 Fig. 3 with image from Bragato et al., 2023
Phenotype of all Fish created by or utilizing MO1-dnm1a
Phenotype Fish Conditions Figures
CaP motoneuron neuron projection decreased branchiness, abnormal AB + MO1-dnm1a + MO4-tp53 control Fig. 4 with image from Bragato et al., 2023
somite C-shaped, abnormal AB + MO1-dnm1a + MO4-tp53 control Fig. 3 with image from Bragato et al., 2023
CaP motoneuron axon ab1-tuba labeling spatial pattern, abnormal AB + MO1-dnm1a + MO4-tp53 control Fig. 4 with image from Bragato et al., 2023
post-vent region curved, abnormal AB + MO1-dnm1a + MO4-tp53 control Fig. 3 with image from Bragato et al., 2023
whole organism Ab-dnm1 labeling decreased amount, abnormal AB + MO1-dnm1a + MO4-tp53 control Fig. 3 with image from Bragato et al., 2023
myotome skeletal muscle myoblast increased amount, abnormal AB + MO1-dnm1a + MO4-tp53 control Fig. 5 with image from Bragato et al., 2023
thigmotaxis process characteristic, abnormal AB + MO1-dnm1a + MO4-tp53 control Table 2 from Bragato et al., 2023
slow muscle cell spatial pattern, abnormal AB + MO1-dnm1a + MO4-tp53 control Fig. 5 with image from Bragato et al., 2023
muscle cell disorganized, abnormal AB + MO1-dnm1a + MO4-tp53 control Fig. 5 with image from Bragato et al., 2023
muscle cell atrophied, abnormal AB + MO1-dnm1a + MO4-tp53 control Fig. 5 with image from Bragato et al., 2023
muscle cell decreased amount, abnormal AB + MO1-dnm1a + MO4-tp53 control Fig. 5 with image from Bragato et al., 2023
muscle cell vacuole increased amount, abnormal AB + MO1-dnm1a + MO4-tp53 control Fig. 5 with image from Bragato et al., 2023
CaP motoneuron neuron projection decreased distribution, abnormal AB + MO1-dnm1a + MO4-tp53 control Fig. 4 with image from Bragato et al., 2023
muscle cell increased distance muscle cell, abnormal AB + MO1-dnm1a + MO4-tp53 control Fig. 5 with image from Bragato et al., 2023
thigmotaxis process characteristic, ameliorated nsfatpl6Gt; tpl131Tg + MO1-dnm1a (AB) control Table 2 from Bragato et al., 2023
Citations