Morpholino

MO1-reep1

ID
ZDB-MRPHLNO-240417-1
Name
MO1-reep1
Previous Names
None
Target
Sequence
5' - ATAATCCAGGAGACCATTGCGCTGT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-reep1
No data available
Phenotype
Phenotype resulting from MO1-reep1
Phenotype Fish Figures
cellular respiration decreased process quality, abnormal WT + MO1-reep1 Figure 5 with image from Naef et al., 2023
head reactive oxygen species increased amount, abnormal WT + MO1-reep1 Figure 6 with image from Naef et al., 2023
musculoskeletal movement decreased process quality, abnormal WT + MO1-reep1 Figure 5 with image from Naef et al., 2023
post-vent region reactive oxygen species increased amount, abnormal WT + MO1-reep1 Figure 6 with image from Naef et al., 2023
spinal accessory motor neuron axon decreased thickness, abnormal WT + MO1-reep1 Figure 5 with image from Naef et al., 2023
spinal accessory motor neuron axon disorganized, abnormal WT + MO1-reep1 Figure 5 with image from Naef et al., 2023
spinal accessory motor neuron axon increased branchiness, abnormal WT + MO1-reep1 Figure 5 with image from Naef et al., 2023
spinal accessory motor neuron axon znp-1 labeling spatial pattern, abnormal WT + MO1-reep1 Figure 5 with image from Naef et al., 2023
swimming behavior decreased process quality, abnormal WT + MO1-reep1 Figure 5 with image from Naef et al., 2023
thigmotaxis decreased process quality, abnormal WT + MO1-reep1 Figure 5 with image from Naef et al., 2023
Phenotype of all Fish created by or utilizing MO1-reep1
Phenotype Fish Conditions Figures
spinal accessory motor neuron axon decreased thickness, abnormal WT + MO1-reep1 control Figure 5 with image from Naef et al., 2023
spinal accessory motor neuron axon disorganized, abnormal WT + MO1-reep1 control Figure 5 with image from Naef et al., 2023
post-vent region reactive oxygen species increased amount, abnormal WT + MO1-reep1 control Figure 6 with image from Naef et al., 2023
spinal accessory motor neuron axon znp-1 labeling spatial pattern, abnormal WT + MO1-reep1 control Figure 5 with image from Naef et al., 2023
swimming behavior decreased process quality, abnormal WT + MO1-reep1 control Figure 5 with image from Naef et al., 2023
spinal accessory motor neuron axon increased branchiness, abnormal WT + MO1-reep1 control Figure 5 with image from Naef et al., 2023
musculoskeletal movement decreased process quality, abnormal WT + MO1-reep1 control Figure 5 with image from Naef et al., 2023
post-vent region reactive oxygen species amount, ameliorated WT + MO1-reep1 chemical treatment by environment: resveratrol Figure 6 with image from Naef et al., 2023
thigmotaxis decreased process quality, abnormal WT + MO1-reep1 control Figure 5 with image from Naef et al., 2023
head reactive oxygen species amount, ameliorated WT + MO1-reep1 chemical treatment by environment: resveratrol Figure 6 with image from Naef et al., 2023
cellular respiration decreased process quality, abnormal WT + MO1-reep1 control Figure 5 with image from Naef et al., 2023
head reactive oxygen species increased amount, abnormal WT + MO1-reep1 control Figure 6 with image from Naef et al., 2023
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.