Morpholino

MO1-gtpbp1l

ID
ZDB-MRPHLNO-230925-1
Name
MO1-gtpbp1l
Previous Names
None
Target
Sequence
5' - GCTGCTTCAGCATCTGTCTGGAAAA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-gtpbp1l
Expressed Gene Anatomy Figures
efnb2a Figure 5 with image from Lo et al., 2022
flt4 Figure 5 with image from Lo et al., 2022
kdrl Figure 5 with image from Lo et al., 2022
mrc1a Figure 5 with image from Lo et al., 2022
stab2 Figure 5 with image from Lo et al., 2022
Phenotype
Phenotype resulting from MO1-gtpbp1l
Phenotype Fish Figures
blood circulation decreased process quality, abnormal sd2Tg; y1Tg + MO1-gtpbp1l Figure 2 with image from Lo et al., 2022
caudal vein plexus morphology, abnormal la116Tg + MO1-gtpbp1l Figure 2 with image from Lo et al., 2022
dorsal aorta efnb2a expression decreased amount, abnormal WT + MO1-gtpbp1l Figure 5 with image from Lo et al., 2022
epidermis apoptotic process increased occurrence, abnormal ci5Tg + MO1-gtpbp1l Figure 4 with image from Lo et al., 2022
intersegmental vessel flt4 expression decreased amount, abnormal WT + MO1-gtpbp1l Figure 5 with image from Lo et al., 2022
intersegmental vessel incomplete structure, abnormal la116Tg + MO1-gtpbp1l Figure 2 with image from Lo et al., 2022
intersegmental vessel blood vessel endothelial cell decreased amount, abnormal ci5Tg; y7Tg + MO1-gtpbp1l Figure 4 with image from Lo et al., 2022
intersegmental vessel blood vessel endothelial cell migration decreased rate, abnormal ci5Tg; y7Tg + MO1-gtpbp1l Figure 4 with image from Lo et al., 2022
pericardium edematous, abnormal sd2Tg; y1Tg + MO1-gtpbp1l Figure 2 with image from Lo et al., 2022
sprouting angiogenesis decreased process quality, abnormal la116Tg + MO1-gtpbp1l Figure 2 with image from Lo et al., 2022
trunk vasculature kdrl expression decreased amount, abnormal WT + MO1-gtpbp1l Figure 5 with image from Lo et al., 2022
trunk vasculature stab2 expression decreased amount, abnormal WT + MO1-gtpbp1l Figure 5 with image from Lo et al., 2022
trunk vasculature vein flt4 expression decreased amount, abnormal WT + MO1-gtpbp1l Figure 5 with image from Lo et al., 2022
trunk vasculature vein mrc1a expression decreased amount, abnormal WT + MO1-gtpbp1l Figure 5 with image from Lo et al., 2022
whole organism kdrl expression decreased amount, abnormal WT + MO1-gtpbp1l Figure 5 with image from Lo et al., 2022
whole organism efnb2a expression decreased amount, abnormal WT + MO1-gtpbp1l Figure 5 with image from Lo et al., 2022
whole organism flt4 expression decreased amount, abnormal WT + MO1-gtpbp1l Figure 5 with image from Lo et al., 2022
whole organism mrc1a expression decreased amount, abnormal WT + MO1-gtpbp1l Figure 5 with image from Lo et al., 2022
whole organism stab2 expression decreased amount, abnormal WT + MO1-gtpbp1l Figure 5 with image from Lo et al., 2022
Phenotype of all Fish created by or utilizing MO1-gtpbp1l
Phenotype Fish Conditions Figures
trunk vasculature vein mrc1a expression decreased amount, abnormal WT + MO1-gtpbp1l control Figure 5 with image from Lo et al., 2022
whole organism flt4 expression decreased amount, abnormal WT + MO1-gtpbp1l control Figure 5 with image from Lo et al., 2022
trunk vasculature stab2 expression decreased amount, abnormal WT + MO1-gtpbp1l control Figure 5 with image from Lo et al., 2022
dorsal aorta efnb2a expression decreased amount, abnormal WT + MO1-gtpbp1l control Figure 5 with image from Lo et al., 2022
intersegmental vessel flt4 expression decreased amount, abnormal WT + MO1-gtpbp1l control Figure 5 with image from Lo et al., 2022
whole organism mrc1a expression decreased amount, abnormal WT + MO1-gtpbp1l control Figure 5 with image from Lo et al., 2022
trunk vasculature kdrl expression decreased amount, abnormal WT + MO1-gtpbp1l control Figure 5 with image from Lo et al., 2022
trunk vasculature vein flt4 expression decreased amount, abnormal WT + MO1-gtpbp1l control Figure 5 with image from Lo et al., 2022
whole organism stab2 expression decreased amount, abnormal WT + MO1-gtpbp1l control Figure 5 with image from Lo et al., 2022
whole organism kdrl expression decreased amount, abnormal WT + MO1-gtpbp1l control Figure 5 with image from Lo et al., 2022
whole organism efnb2a expression decreased amount, abnormal WT + MO1-gtpbp1l control Figure 5 with image from Lo et al., 2022
epidermis apoptotic process increased occurrence, abnormal ci5Tg + MO1-gtpbp1l standard conditions Figure 4 with image from Lo et al., 2022
caudal vein plexus morphology, abnormal la116Tg + MO1-gtpbp1l standard conditions Figure 2 with image from Lo et al., 2022
intersegmental vessel incomplete structure, abnormal la116Tg + MO1-gtpbp1l standard conditions Figure 2 with image from Lo et al., 2022
sprouting angiogenesis decreased process quality, abnormal la116Tg + MO1-gtpbp1l standard conditions Figure 2 with image from Lo et al., 2022
intersegmental vessel blood vessel endothelial cell migration decreased rate, abnormal ci5Tg; y7Tg + MO1-gtpbp1l standard conditions Figure 4 with image from Lo et al., 2022
intersegmental vessel blood vessel endothelial cell decreased amount, abnormal ci5Tg; y7Tg + MO1-gtpbp1l standard conditions Figure 4 with image from Lo et al., 2022
pericardium edematous, abnormal sd2Tg; y1Tg + MO1-gtpbp1l standard conditions Figure 2 with image from Lo et al., 2022
blood circulation decreased process quality, abnormal sd2Tg; y1Tg + MO1-gtpbp1l standard conditions Figure 2 with image from Lo et al., 2022
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.