Morpholino

MO1-zgc:112052

ID
ZDB-MRPHLNO-210907-3
Name
MO1-zgc:112052
Previous Names
None
Target
Sequence
5' - CGGCATAGTGCTTGGAAAGATTACA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-zgc:112052
No data available
Phenotype
Phenotype resulting from MO1-zgc:112052
Phenotype Fish Figures
brain decreased size, abnormal AB + MO1-zgc:112052 FIGURE 2 with imageFIGURE 3 with image from Mignani et al., 2020
brain morphology, abnormal AB + MO1-zgc:112052 FIGURE 2 with imageFIGURE 3 with image from Mignani et al., 2020
dorsal root ganglion neuron EGFP expression decreased amount, abnormal w61Tg + MO1-zgc:112052 FIGURE 4 with image from Mignani et al., 2020
eye decreased diameter, abnormal AB + MO1-zgc:112052 + MO4-tp53 FIGURE 2 with imageFIGURE 3 with image from Mignani et al., 2020
eye decreased size, abnormal AB + MO1-zgc:112052 FIGURE 2 with imageFIGURE 3 with image from Mignani et al., 2020
heart edematous, abnormal AB + MO1-zgc:112052 FIGURE 2 with image from Mignani et al., 2020
midbrain hindbrain boundary EGFP expression decreased amount, abnormal ia50Tg + MO1-zgc:112052 FIGURE 5 with image from Mignani et al., 2020
optic tectum EGFP expression decreased amount, abnormal w61Tg + MO1-zgc:112052 FIGURE 4 with imageFIGURE 5 with image from Mignani et al., 2020
post-vent region curved, abnormal AB + MO1-zgc:112052 FIGURE 2 with image from Mignani et al., 2020
post-vent region decreased thickness, abnormal AB + MO1-zgc:112052 FIGURE 2 with image from Mignani et al., 2020
skeletal muscle refractivity, abnormal AB + MO1-zgc:112052 FIGURE 6 with image from Mignani et al., 2020
skeletal muscle filamentous actin disorganized, abnormal AB + MO1-zgc:112052 FIGURE 6 with image from Mignani et al., 2020
somite development disrupted, abnormal AB + MO1-zgc:112052 FIGURE 2 with image from Mignani et al., 2020
thigmotaxis process quality, abnormal AB + MO1-zgc:112052 FIGURE 7 with image from Mignani et al., 2020
trunk decreased size, abnormal AB + MO1-zgc:112052 FIGURE 6 with image from Mignani et al., 2020
whole organism dead, abnormal AB + MO1-zgc:112052 FIGURE 2 with image from Mignani et al., 2020
whole organism decreased life span, abnormal AB + MO1-zgc:112052 FIGURE 2 with image from Mignani et al., 2020
Phenotype of all Fish created by or utilizing MO1-zgc:112052
Phenotype Fish Conditions Figures
heart edematous, abnormal AB + MO1-zgc:112052 standard conditions FIGURE 2 with image from Mignani et al., 2020
trunk decreased size, abnormal AB + MO1-zgc:112052 standard conditions FIGURE 6 with image from Mignani et al., 2020
brain decreased size, abnormal AB + MO1-zgc:112052 standard conditions FIGURE 2 with image from Mignani et al., 2020
somite development disrupted, abnormal AB + MO1-zgc:112052 standard conditions FIGURE 2 with image from Mignani et al., 2020
post-vent region decreased thickness, abnormal AB + MO1-zgc:112052 standard conditions FIGURE 2 with image from Mignani et al., 2020
brain morphology, abnormal AB + MO1-zgc:112052 standard conditions FIGURE 2 with image from Mignani et al., 2020
whole organism dead, abnormal AB + MO1-zgc:112052 standard conditions FIGURE 2 with image from Mignani et al., 2020
skeletal muscle filamentous actin disorganized, abnormal AB + MO1-zgc:112052 standard conditions FIGURE 6 with image from Mignani et al., 2020
whole organism decreased life span, abnormal AB + MO1-zgc:112052 standard conditions FIGURE 2 with image from Mignani et al., 2020
eye decreased size, abnormal AB + MO1-zgc:112052 standard conditions FIGURE 2 with image from Mignani et al., 2020
eye decreased diameter, abnormal AB + MO1-zgc:112052 standard conditions FIGURE 2 with image from Mignani et al., 2020
skeletal muscle refractivity, abnormal AB + MO1-zgc:112052 standard conditions FIGURE 6 with image from Mignani et al., 2020
thigmotaxis process quality, abnormal AB + MO1-zgc:112052 standard conditions FIGURE 7 with image from Mignani et al., 2020
post-vent region curved, abnormal AB + MO1-zgc:112052 standard conditions FIGURE 2 with image from Mignani et al., 2020
brain decreased size, abnormal AB + MO1-zgc:112052 + MO4-tp53 standard conditions FIGURE 3 with image from Mignani et al., 2020
brain morphology, abnormal AB + MO1-zgc:112052 + MO4-tp53 standard conditions FIGURE 3 with image from Mignani et al., 2020
eye decreased diameter, abnormal AB + MO1-zgc:112052 + MO4-tp53 standard conditions FIGURE 3 with image from Mignani et al., 2020
eye decreased size, abnormal AB + MO1-zgc:112052 + MO4-tp53 standard conditions FIGURE 3 with image from Mignani et al., 2020
midbrain hindbrain boundary EGFP expression decreased amount, abnormal ia50Tg + MO1-zgc:112052 standard conditions FIGURE 5 with image from Mignani et al., 2020
optic tectum EGFP expression decreased amount, abnormal ia50Tg + MO1-zgc:112052 standard conditions FIGURE 5 with image from Mignani et al., 2020
dorsal root ganglion neuron EGFP expression decreased amount, abnormal w61Tg + MO1-zgc:112052 standard conditions FIGURE 4 with image from Mignani et al., 2020
optic tectum EGFP expression decreased amount, abnormal w61Tg + MO1-zgc:112052 standard conditions FIGURE 4 with image from Mignani et al., 2020
Citations