Morpholino

MO2-cgasa

ID
ZDB-MRPHLNO-210304-1
Name
MO2-cgasa
Previous Names
  • MO2-cgas
Target
Sequence
5' - CATGATGGCAGGTGTGTTCACGAGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-cgasa
No data available
Phenotype
Phenotype resulting from MO2-cgasa
No data available
Phenotype of all Fish created by or utilizing MO2-cgasa
Phenotype Fish Conditions Figures
head kidney hamp expression amount, ameliorated WT + MO2-cgasa bacterial treatment by exposure to environment: Aeromonas hydrophila Fig. 9 from Liu et al., 2020
whole organism hamp expression amount, ameliorated WT + MO2-cgasa bacterial treatment by exposure to environment: Aeromonas hydrophila Fig. 9 from Liu et al., 2020
head kidney ifnphi1 expression amount, ameliorated WT + MO2-cgasa bacterial treatment by exposure to environment: Aeromonas hydrophila Fig. 9 from Liu et al., 2020
whole organism il6 expression amount, ameliorated WT + MO2-cgasa bacterial treatment by exposure to environment: Aeromonas hydrophila Fig. 9 from Liu et al., 2020
head kidney irf3 expression amount, ameliorated WT + MO2-cgasa bacterial treatment by exposure to environment: Aeromonas hydrophila Fig. 9 from Liu et al., 2020
whole organism dead, exacerbated WT + MO2-cgasa bacterial treatment by exposure to environment: Edwardsiella tarda Fig. 9 from Liu et al., 2020
head kidney il1b expression amount, ameliorated WT + MO2-cgasa bacterial treatment by exposure to environment: Aeromonas hydrophila Fig. 9 from Liu et al., 2020
whole organism irf3 expression amount, ameliorated WT + MO2-cgasa bacterial treatment by exposure to environment: Aeromonas hydrophila Fig. 9 from Liu et al., 2020
whole organism dead, exacerbated WT + MO2-cgasa bacterial treatment by exposure to environment: Aeromonas hydrophila Fig. 9 from Liu et al., 2020
head kidney ifnphi3 expression amount, ameliorated WT + MO2-cgasa bacterial treatment by exposure to environment: Aeromonas hydrophila Fig. 9 from Liu et al., 2020
whole organism il1b expression amount, ameliorated WT + MO2-cgasa bacterial treatment by exposure to environment: Aeromonas hydrophila Fig. 9 from Liu et al., 2020
whole organism ifnphi1 expression amount, ameliorated WT + MO2-cgasa bacterial treatment by exposure to environment: Aeromonas hydrophila Fig. 9 from Liu et al., 2020
head kidney il6 expression amount, ameliorated WT + MO2-cgasa bacterial treatment by exposure to environment: Aeromonas hydrophila Fig. 9 from Liu et al., 2020
whole organism ifnphi3 expression amount, ameliorated WT + MO2-cgasa bacterial treatment by exposure to environment: Aeromonas hydrophila Fig. 9 from Liu et al., 2020
whole organism dead, exacerbated WT + MO2-cgasa viral treatment by exposure to environment: Rhabdoviridae Fig. 9 from Liu et al., 2020
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.