Community Action Needed: Please respond to the NIH RFI
Morpholino

MO6-dysf

ID
ZDB-MRPHLNO-201109-1
Name
MO6-dysf
Previous Names
None
Target
Sequence
5' - GAAACCTGCAAACATACACAAAGGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO6-dysf
Expressed Gene Anatomy Figures
dysf Fig. 7 with image from Ono et al., 2020
Phenotype
Phenotype resulting from MO6-dysf
Phenotype of all Fish created by or utilizing MO6-dysf
Citations