Morpholino

MO2-glis3

ID
ZDB-MRPHLNO-200914-1
Name
MO2-glis3
Previous Names
None
Target
Sequence
5' - TTCTTGTTTTTACCTTTCATACCGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-glis3
No data available
Phenotype
Phenotype resulting from MO2-glis3
Phenotype Fish Figures
endocrine pancreas ins expression decreased amount, abnormal AB + MO2-glis3 Fig. 4 from Rurale et al., 2019
endocrine pancreas morphology, abnormal AB + MO2-glis3 Fig. 4 from Rurale et al., 2019
endocrine pancreas ins expression spatial pattern, abnormal AB + MO2-glis3 Fig. 4 from Rurale et al., 2019
hypophysis tshba expression increased amount, abnormal AB + MO2-glis3 Fig. 2 from Rurale et al., 2019
hypophysis tshba expression increased distribution, abnormal AB + MO2-glis3 Fig. 2 from Rurale et al., 2019
pharyngeal endoderm nkx2.4b expression decreased amount, abnormal AB + MO2-glis3 Fig. 1 from Rurale et al., 2019
pharyngeal endoderm pax2a expression decreased amount, abnormal AB + MO2-glis3 Fig. 1 from Rurale et al., 2019
pharynx endoderm shha expression decreased amount, abnormal AB + MO2-glis3 Fig. 5 from Rurale et al., 2019
thyroid follicle decreased amount, abnormal AB + MO2-glis3 Fig. 2 from Rurale et al., 2019
thyroid follicle slc5a5 expression decreased amount, abnormal AB + MO2-glis3 Fig. 2 from Rurale et al., 2019
thyroid follicle tg expression decreased amount, abnormal AB + MO2-glis3 Fig. 2 from Rurale et al., 2019
thyroid follicle disorganized, abnormal AB + MO2-glis3 Fig. 2 from Rurale et al., 2019
thyroid follicle morphology, abnormal AB + MO2-glis3 Fig. 2 from Rurale et al., 2019
thyroid follicle tg expression spatial pattern, abnormal AB + MO2-glis3 Fig. 2 from Rurale et al., 2019
thyroid primordium absent, abnormal AB + MO2-glis3 Fig. 1 from Rurale et al., 2019
thyroid primordium decreased volume, abnormal AB + MO2-glis3 Fig. 1 from Rurale et al., 2019
Phenotype of all Fish created by or utilizing MO2-glis3
Phenotype Fish Conditions Figures
thyroid follicle decreased amount, abnormal AB + MO2-glis3 control Fig. 2 from Rurale et al., 2019
thyroid follicle slc5a5 expression decreased amount, abnormal AB + MO2-glis3 control Fig. 2 from Rurale et al., 2019
thyroid primordium decreased volume, abnormal AB + MO2-glis3 control Fig. 1 from Rurale et al., 2019
endocrine pancreas ins expression spatial pattern, abnormal AB + MO2-glis3 control Fig. 4 from Rurale et al., 2019
pharyngeal endoderm nkx2.4b expression decreased amount, abnormal AB + MO2-glis3 control Fig. 1 from Rurale et al., 2019
thyroid follicle tg expression decreased amount, abnormal AB + MO2-glis3 control Fig. 2 from Rurale et al., 2019
thyroid follicle disorganized, abnormal AB + MO2-glis3 control Fig. 2 from Rurale et al., 2019
endocrine pancreas morphology, abnormal AB + MO2-glis3 control Fig. 4 from Rurale et al., 2019
thyroid follicle morphology, abnormal AB + MO2-glis3 control Fig. 2 from Rurale et al., 2019
endocrine pancreas ins expression decreased amount, abnormal AB + MO2-glis3 control Fig. 4 from Rurale et al., 2019
thyroid primordium absent, abnormal AB + MO2-glis3 control Fig. 1 from Rurale et al., 2019
pharynx endoderm shha expression decreased amount, abnormal AB + MO2-glis3 control Fig. 5 from Rurale et al., 2019
pharyngeal endoderm pax2a expression decreased amount, abnormal AB + MO2-glis3 control Fig. 1 from Rurale et al., 2019
hypophysis tshba expression increased distribution, abnormal AB + MO2-glis3 control Fig. 2 from Rurale et al., 2019
thyroid follicle tg expression spatial pattern, abnormal AB + MO2-glis3 control Fig. 2 from Rurale et al., 2019
hypophysis tshba expression increased amount, abnormal AB + MO2-glis3 control Fig. 2 from Rurale et al., 2019
Citations