Morpholino

MO2-glis3

ID
ZDB-MRPHLNO-200914-1
Name
MO2-glis3
Previous Names
None
Target
Sequence
5' - TTCTTGTTTTTACCTTTCATACCGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-glis3
Expressed Gene Anatomy Figures
foxa2 Fig. 4 from Rurale et al., 2019
foxa3 Fig. 4 from Rurale et al., 2019
ins Fig. 4 from Rurale et al., 2019
isl1a Fig. 4 from Rurale et al., 2019
nkx2.4b Fig. 1 from Rurale et al., 2019
pax2a Fig. 1 from Rurale et al., 2019
ptf1a Fig. S5 from Rurale et al., 2019
shha Fig. 5 from Rurale et al., 2019
slc5a5 Fig. 2 from Rurale et al., 2019
tg Fig. 2 from Rurale et al., 2019
tshba Fig. 2 from Rurale et al., 2019
Phenotype
Phenotype resulting from MO2-glis3
Phenotype Fish Figures
endocrine pancreas ins expression decreased amount, abnormal AB + MO2-glis3 Fig. 4 from Rurale et al., 2019
endocrine pancreas morphology, abnormal AB + MO2-glis3 Fig. 4 from Rurale et al., 2019
endocrine pancreas ins expression spatial pattern, abnormal AB + MO2-glis3 Fig. 4 from Rurale et al., 2019
hypophysis tshba expression increased amount, abnormal AB + MO2-glis3 Fig. 2 from Rurale et al., 2019
hypophysis tshba expression increased distribution, abnormal AB + MO2-glis3 Fig. 2 from Rurale et al., 2019
pharyngeal endoderm nkx2.4b expression decreased amount, abnormal AB + MO2-glis3 Fig. 1 from Rurale et al., 2019
pharyngeal endoderm pax2a expression decreased amount, abnormal AB + MO2-glis3 Fig. 1 from Rurale et al., 2019
pharynx endoderm shha expression decreased amount, abnormal AB + MO2-glis3 Fig. 5 from Rurale et al., 2019
thyroid follicle decreased amount, abnormal AB + MO2-glis3 Fig. 2 from Rurale et al., 2019
thyroid follicle slc5a5 expression decreased amount, abnormal AB + MO2-glis3 Fig. 2 from Rurale et al., 2019
thyroid follicle tg expression decreased amount, abnormal AB + MO2-glis3 Fig. 2 from Rurale et al., 2019
thyroid follicle disorganized, abnormal AB + MO2-glis3 Fig. 2 from Rurale et al., 2019
thyroid follicle morphology, abnormal AB + MO2-glis3 Fig. 2 from Rurale et al., 2019
thyroid follicle tg expression spatial pattern, abnormal AB + MO2-glis3 Fig. 2 from Rurale et al., 2019
thyroid primordium absent, abnormal AB + MO2-glis3 Fig. 1 from Rurale et al., 2019
thyroid primordium decreased volume, abnormal AB + MO2-glis3 Fig. 1 from Rurale et al., 2019
Phenotype of all Fish created by or utilizing MO2-glis3
Phenotype Fish Conditions Figures
thyroid follicle decreased amount, abnormal AB + MO2-glis3 control Fig. 2 from Rurale et al., 2019
thyroid follicle slc5a5 expression decreased amount, abnormal AB + MO2-glis3 control Fig. 2 from Rurale et al., 2019
thyroid primordium decreased volume, abnormal AB + MO2-glis3 control Fig. 1 from Rurale et al., 2019
endocrine pancreas ins expression spatial pattern, abnormal AB + MO2-glis3 control Fig. 4 from Rurale et al., 2019
pharyngeal endoderm nkx2.4b expression decreased amount, abnormal AB + MO2-glis3 control Fig. 1 from Rurale et al., 2019
thyroid follicle tg expression decreased amount, abnormal AB + MO2-glis3 control Fig. 2 from Rurale et al., 2019
thyroid follicle disorganized, abnormal AB + MO2-glis3 control Fig. 2 from Rurale et al., 2019
endocrine pancreas morphology, abnormal AB + MO2-glis3 control Fig. 4 from Rurale et al., 2019
thyroid follicle morphology, abnormal AB + MO2-glis3 control Fig. 2 from Rurale et al., 2019
endocrine pancreas ins expression decreased amount, abnormal AB + MO2-glis3 control Fig. 4 from Rurale et al., 2019
thyroid primordium absent, abnormal AB + MO2-glis3 control Fig. 1 from Rurale et al., 2019
pharynx endoderm shha expression decreased amount, abnormal AB + MO2-glis3 control Fig. 5 from Rurale et al., 2019
pharyngeal endoderm pax2a expression decreased amount, abnormal AB + MO2-glis3 control Fig. 1 from Rurale et al., 2019
hypophysis tshba expression increased distribution, abnormal AB + MO2-glis3 control Fig. 2 from Rurale et al., 2019
thyroid follicle tg expression spatial pattern, abnormal AB + MO2-glis3 control Fig. 2 from Rurale et al., 2019
hypophysis tshba expression increased amount, abnormal AB + MO2-glis3 control Fig. 2 from Rurale et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.