Morpholino

MO1-h2az2a

ID
ZDB-MRPHLNO-200909-3
Name
MO1-h2az2a
Previous Names
  • Z.2 MO (1)
Target
Sequence
5' - CCACCTGCCATTTCAGCGATGT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-h2az2a
No data available
Phenotype
Phenotype resulting from MO1-h2az2a
Phenotype Fish Figures
head melanocyte decreased amount, abnormal WT + MO1-h2az2a Fig. 3 with image from Raja et al., 2020
lateral line melanocyte decreased amount, abnormal WT + MO1-h2az2a Fig. 1 with imageFig. 2 with image from Raja et al., 2020
lateral line myelinating Schwann cell mbpa expression decreased amount, abnormal WT + MO1-h2az2a Fig. 2 with image from Raja et al., 2020
lateral line myelinating Schwann cell GFP expression decreased amount, abnormal zf15Tg + MO1-h2az2a Fig. 2 with image from Raja et al., 2020
lateral line myelinating Schwann cell egr2b expression decreased amount, abnormal WT + MO1-h2az2a Fig. 2 with image from Raja et al., 2020
lateral line myelinating Schwann cell decreased amount, abnormal WT + MO1-h2az2a Fig. 2 with image from Raja et al., 2020
melanoblast decreased amount, abnormal w47Tg + MO1-h2az2a Fig. 1 with image from Raja et al., 2020
melanocyte kita expression decreased amount, abnormal WT + MO1-h2az2a Fig. 2 with image from Raja et al., 2020
melanocyte mitfa expression decreased amount, abnormal WT + MO1-h2az2a Fig. 3 with image from Raja et al., 2020
melanocyte decreased amount, abnormal w47Tg + MO1-h2az2a Fig. 1 with imageFig. 3 with image from Raja et al., 2020
melanocyte dct expression decreased amount, abnormal WT + MO1-h2az2a Fig. 2 with image from Raja et al., 2020
neural crest cell decreased amount, abnormal ba2Tg + MO1-h2az2a Fig. 1 with image from Raja et al., 2020
pigmentation decreased occurrence, abnormal WT + MO1-h2az2a Fig. 1 with image from Raja et al., 2020
spinal cord CNS neuron (sensu Vertebrata) mislocalised, abnormal zf148Tg + MO1-h2az2a Fig. 2 with image from Raja et al., 2020
whole organism Ab3-h2a labeling decreased amount, abnormal WT + MO1-h2az2a Fig. 1 with image from Raja et al., 2020
Phenotype of all Fish created by or utilizing MO1-h2az2a
Phenotype Fish Conditions Figures
head melanocyte decreased amount, abnormal WT + MO1-h2az2a standard conditions Fig. 3 with image from Raja et al., 2020
melanocyte mitfa expression decreased amount, abnormal WT + MO1-h2az2a standard conditions Fig. 3 with image from Raja et al., 2020
melanocyte decreased amount, abnormal WT + MO1-h2az2a standard conditions Fig. 3 with image from Raja et al., 2020
lateral line myelinating Schwann cell decreased amount, abnormal WT + MO1-h2az2a standard conditions Fig. 2 with image from Raja et al., 2020
lateral line melanocyte decreased amount, abnormal WT + MO1-h2az2a standard conditions Fig. 1 with imageFig. 2 with image from Raja et al., 2020
lateral line myelinating Schwann cell mbpa expression decreased amount, abnormal WT + MO1-h2az2a standard conditions Fig. 2 with image from Raja et al., 2020
lateral line myelinating Schwann cell egr2b expression decreased amount, abnormal WT + MO1-h2az2a standard conditions Fig. 2 with image from Raja et al., 2020
pigmentation decreased occurrence, abnormal WT + MO1-h2az2a standard conditions Fig. 1 with image from Raja et al., 2020
melanocyte kita expression decreased amount, abnormal WT + MO1-h2az2a standard conditions Fig. 2 with image from Raja et al., 2020
melanocyte dct expression decreased amount, abnormal WT + MO1-h2az2a standard conditions Fig. 2 with image from Raja et al., 2020
whole organism Ab3-h2a labeling decreased amount, abnormal WT + MO1-h2az2a standard conditions Fig. 1 with image from Raja et al., 2020
neural crest cell decreased amount, abnormal ba2Tg + MO1-h2az2a standard conditions Fig. 1 with image from Raja et al., 2020
melanoblast decreased amount, abnormal w47Tg + MO1-h2az2a standard conditions Fig. 1 with image from Raja et al., 2020
melanocyte decreased amount, abnormal w47Tg + MO1-h2az2a standard conditions Fig. 3 with image from Raja et al., 2020
lateral line myelinating Schwann cell decreased amount, abnormal zf15Tg + MO1-h2az2a standard conditions Fig. 2 with image from Raja et al., 2020
lateral line myelinating Schwann cell GFP expression decreased amount, abnormal zf15Tg + MO1-h2az2a standard conditions Fig. 2 with image from Raja et al., 2020
spinal cord CNS neuron (sensu Vertebrata) mislocalised, abnormal zf148Tg + MO1-h2az2a standard conditions Fig. 2 with image from Raja et al., 2020
melanocyte decreased amount, abnormal zf3349Tg + MO1-h2az2a standard conditions Fig. 1 with image from Raja et al., 2020
Citations