Morpholino

MO1-polr1b

ID

ZDB-MRPHLNO-200902-1

Name

MO1-polr1b

Previous Names

None

Target

polr1b (1)

Sequence

5' - TTGCACCACTTGGAGAGATCCATGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-polr1b

No data available

Phenotype

Phenotype resulting from MO1-polr1b

Phenotype	Fish	Figures
apoptotic process increased occurrence, abnormal	ba2Tg + MO1-polr1b	Fig. 4 from Sanchez et al., 2019
embryo development delayed, abnormal	AB + MO1-polr1b	Fig. 3 from Sanchez et al., 2019
eye decreased size, abnormal	AB + MO1-polr1b	Fig. 3 from Sanchez et al., 2019
head decreased size, abnormal	AB + MO1-polr1b	Fig. 3 from Sanchez et al., 2019
heart edematous, abnormal	hu5910Tg + MO1-polr1b	Fig. 3 from Sanchez et al., 2019
migratory neural crest cell decreased amount, abnormal	zf15Tg + MO1-polr1b	Fig. 3 from Sanchez et al., 2019
neuroepithelial cell apoptotic process increased occurrence, abnormal	ba2Tg + MO1-polr1b	Fig. 4 from Sanchez et al., 2019
otic vesicle decreased size, abnormal	hu5910Tg + MO1-polr1b	Fig. 3 from Sanchez et al., 2019
pharyngeal arch 1 absent, abnormal	hu5910Tg + MO1-polr1b	Fig. 3 from Sanchez et al., 2019
pharyngeal arch 3-7 absent, abnormal	hu5910Tg + MO1-polr1b	Fig. 3 from Sanchez et al., 2019
pigmentation disrupted, abnormal	hu5910Tg + MO1-polr1b	Fig. 3 from Sanchez et al., 2019
premigratory neural crest cell ribosome biogenesis disrupted, abnormal	AB + MO1-polr1b	Fig. 4 from Sanchez et al., 2019
RNA polymerase I activity disrupted, abnormal	AB + MO1-polr1b	Fig. 4 from Sanchez et al., 2019
whole organism decreased size, abnormal	AB + MO1-polr1b	Fig. 3 from Sanchez et al., 2019
whole organism degree of pigmentation, abnormal	AB + MO1-polr1b	Fig. 3 from Sanchez et al., 2019

Phenotype of all Fish created by or utilizing MO1-polr1b

Phenotype	Fish	Conditions	Figures
whole organism degree of pigmentation, abnormal	AB + MO1-polr1b	standard conditions	Fig. 3 from Sanchez et al., 2019
embryo development delayed, abnormal	AB + MO1-polr1b	standard conditions	Fig. 3 from Sanchez et al., 2019
RNA polymerase I activity disrupted, abnormal	AB + MO1-polr1b	standard conditions	Fig. 4 from Sanchez et al., 2019
heart edematous, abnormal	AB + MO1-polr1b	standard conditions	Fig. 3 from Sanchez et al., 2019
premigratory neural crest cell ribosome biogenesis disrupted, abnormal	AB + MO1-polr1b	standard conditions	Fig. 4 from Sanchez et al., 2019
eye decreased size, abnormal	AB + MO1-polr1b	standard conditions	Fig. 3 from Sanchez et al., 2019
head decreased size, abnormal	AB + MO1-polr1b	standard conditions	Fig. 3 from Sanchez et al., 2019
whole organism decreased size, abnormal	AB + MO1-polr1b	standard conditions	Fig. 3 from Sanchez et al., 2019
apoptotic process increased occurrence, abnormal	ba2Tg + MO1-polr1b	standard conditions	Fig. 4 from Sanchez et al., 2019
neuroepithelial cell apoptotic process increased occurrence, abnormal	ba2Tg + MO1-polr1b	standard conditions	Fig. 4 from Sanchez et al., 2019
migratory neural crest cell decreased amount, abnormal	ba2Tg + MO1-polr1b	standard conditions	Fig. 3 from Sanchez et al., 2019
pharyngeal arch 3-7 absent, abnormal	hu5910Tg + MO1-polr1b	standard conditions	Fig. 3 from Sanchez et al., 2019
otic vesicle decreased size, abnormal	hu5910Tg + MO1-polr1b	standard conditions	Fig. 3 from Sanchez et al., 2019
pharyngeal arch 1 absent, abnormal	hu5910Tg + MO1-polr1b	standard conditions	Fig. 3 from Sanchez et al., 2019
pigmentation disrupted, abnormal	hu5910Tg + MO1-polr1b	standard conditions	Fig. 3 from Sanchez et al., 2019
heart edematous, abnormal	hu5910Tg + MO1-polr1b	standard conditions	Fig. 3 from Sanchez et al., 2019
migratory neural crest cell decreased amount, abnormal	zf15Tg + MO1-polr1b	standard conditions	Fig. 3 from Sanchez et al., 2019

Citations