Morpholino

MO3-trpv4

ID
ZDB-MRPHLNO-200821-1
Name
MO3-trpv4
Previous Names
None
Target
Sequence
5' - AGTAGAGTGGAAGCAGAAAAACCCT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-trpv4
No data available
Phenotype
Phenotype resulting from MO3-trpv4
Phenotype Fish Figures
ball acid secretion decreased occurrence, abnormal AB + MO3-trpv4 Fig. 3 from Liu et al., 2020
epidermal stem cell decreased accumulation yolk syncytial layer integument, abnormal AB + MO3-trpv4 Fig. 5 from Liu et al., 2020
epidermal stem cell decreased amount, abnormal AB + MO3-trpv4 Fig. 5 from Liu et al., 2020
integument acid secretion decreased occurrence, abnormal AB + MO3-trpv4 Fig. 3 from Liu et al., 2020
NaK ionocyte decreased accumulation yolk syncytial layer integument, abnormal AB + MO3-trpv4 Fig. 5 from Liu et al., 2020
NaK ionocyte decreased amount, abnormal AB + MO3-trpv4 Fig. 5 from Liu et al., 2020
vH ionocyte decreased accumulation yolk syncytial layer integument, abnormal AB + MO3-trpv4 Fig. 5 from Liu et al., 2020
vH ionocyte decreased amount, abnormal AB + MO3-trpv4 Fig. 5 from Liu et al., 2020
vH ionocyte acid secretion decreased occurrence, abnormal AB + MO3-trpv4 Fig. 3 from Liu et al., 2020
whole organism slc12a10.2 expression decreased amount, abnormal AB + MO3-trpv4 Fig. 4 from Liu et al., 2020
whole organism trpv6 expression decreased amount, abnormal AB + MO3-trpv4 Fig. 4 from Liu et al., 2020
whole organism atp6v1aa expression decreased amount, abnormal AB + MO3-trpv4 Fig. 4 from Liu et al., 2020
whole organism oxt expression decreased amount, abnormal AB + MO3-trpv4 Fig. 2 from Liu et al., 2020
whole organism calcium(2+) decreased amount, abnormal AB + MO3-trpv4 Fig. 3 from Liu et al., 2020
whole organism chloride decreased amount, abnormal AB + MO3-trpv4 Fig. 3 from Liu et al., 2020
whole organism sodium(1+) decreased amount, abnormal AB + MO3-trpv4 Fig. 3 from Liu et al., 2020
Phenotype of all Fish created by or utilizing MO3-trpv4
Phenotype Fish Conditions Figures
whole organism slc12a10.2 expression decreased amount, abnormal AB + MO3-trpv4 standard conditions Fig. 4 from Liu et al., 2020
whole organism atp6v1aa expression decreased amount, abnormal AB + MO3-trpv4 standard conditions Fig. 4 from Liu et al., 2020
integument acid secretion decreased occurrence, abnormal AB + MO3-trpv4 standard conditions Fig. 3 from Liu et al., 2020
epidermal stem cell decreased accumulation yolk syncytial layer integument, abnormal AB + MO3-trpv4 standard conditions Fig. 5 from Liu et al., 2020
whole organism trpv6 expression decreased amount, abnormal AB + MO3-trpv4 standard conditions Fig. 4 from Liu et al., 2020
NaK ionocyte decreased accumulation yolk syncytial layer integument, abnormal AB + MO3-trpv4 standard conditions Fig. 5 from Liu et al., 2020
ball acid secretion decreased occurrence, abnormal AB + MO3-trpv4 standard conditions Fig. 3 from Liu et al., 2020
whole organism sodium(1+) decreased amount, abnormal AB + MO3-trpv4 standard conditions Fig. 3 from Liu et al., 2020
whole organism oxt expression decreased amount, abnormal AB + MO3-trpv4 standard conditions Fig. 2 from Liu et al., 2020
vH ionocyte decreased amount, abnormal AB + MO3-trpv4 standard conditions Fig. 5 from Liu et al., 2020
whole organism calcium(2+) decreased amount, abnormal AB + MO3-trpv4 standard conditions Fig. 3 from Liu et al., 2020
vH ionocyte decreased accumulation yolk syncytial layer integument, abnormal AB + MO3-trpv4 standard conditions Fig. 5 from Liu et al., 2020
NaK ionocyte decreased amount, abnormal AB + MO3-trpv4 standard conditions Fig. 5 from Liu et al., 2020
epidermal stem cell decreased amount, abnormal AB + MO3-trpv4 standard conditions Fig. 5 from Liu et al., 2020
whole organism chloride decreased amount, abnormal AB + MO3-trpv4 standard conditions Fig. 3 from Liu et al., 2020
vH ionocyte acid secretion decreased occurrence, abnormal AB + MO3-trpv4 standard conditions Fig. 3 from Liu et al., 2020
Citations