Morpholino

MO1-pnpo

ID

ZDB-MRPHLNO-200506-1

Name

MO1-pnpo

Previous Names

None

Target

pnpo (1)

Sequence

5' - ACGTCTCATGCTTGTTCCGCG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-pnpo

Expressed Gene	Anatomy	Figures
pax2a	midbrain hindbrain boundary	Figure 5 from Chen et al., 2019
pnpo	whole organism	Figure 4 from Chen et al., 2019

Phenotype

Phenotype resulting from MO1-pnpo

Phenotype	Fish	Figures
atrium position, abnormal	hn1Tg + MO1-pnpo	Figure 5 from Chen et al., 2019
blood circulation disrupted, abnormal	hn1Tg + MO1-pnpo	text only from Chen et al., 2019
brain morphology, abnormal	AB + MO1-pnpo	Figure 6 from Chen et al., 2019
brain structure, cavities, abnormal	AB + MO1-pnpo	Figure 5 from Chen et al., 2019
cardiac ventricle position, abnormal	hn1Tg + MO1-pnpo	Figure 5 from Chen et al., 2019
caudal fin malformed, abnormal	AB + MO1-pnpo	Figure 5 from Chen et al., 2019
eye decreased size, abnormal	AB + MO1-pnpo	Figure 6 from Chen et al., 2019
heart linear, abnormal	hn1Tg + MO1-pnpo	Figure 5 from Chen et al., 2019
heart morphology, abnormal	AB + MO1-pnpo	Figure 6 from Chen et al., 2019
heart looping disrupted, abnormal	hn1Tg + MO1-pnpo	Figure 5 from Chen et al., 2019
locomotory behavior increased process quality, abnormal	AB + MO1-pnpo	Figure 7 from Chen et al., 2019
midbrain hindbrain boundary pax2a expression decreased amount, abnormal	nz4Tg + MO1-pnpo	Figure 5 from Chen et al., 2019
neural crest cell mislocalised, abnormal	nz4Tg + MO1-pnpo	Figure 5 from Chen et al., 2019
neural crest cell migration disrupted, abnormal	nz4Tg + MO1-pnpo	Figure 5 from Chen et al., 2019
neural tube closure arrested, abnormal	AB + MO1-pnpo	Figure 5 from Chen et al., 2019
somite cuboid, abnormal	AB + MO1-pnpo	Figure 5 from Chen et al., 2019
swim bladder malformed, abnormal	AB + MO1-pnpo	Figure 6 from Chen et al., 2019
swimming behavior decreased process quality, abnormal	AB + MO1-pnpo	Figure 8 from Chen et al., 2019
third ventricle morphology, abnormal	AB + MO1-pnpo	Figure 5 from Chen et al., 2019
third ventricle open, abnormal	AB + MO1-pnpo	Figure 5 from Chen et al., 2019
trunk curved ventral, abnormal	AB + MO1-pnpo	Figure 5 from Chen et al., 2019
trunk malformed, abnormal	AB + MO1-pnpo	Figure 5 from Chen et al., 2019
trunk morphology, abnormal	AB + MO1-pnpo	Figure 6 from Chen et al., 2019
ventricular system development disrupted, abnormal	AB + MO1-pnpo	Figure 5 from Chen et al., 2019
whole organism pnpo expression decreased amount, abnormal	AB + MO1-pnpo	Figure 4 from Chen et al., 2019
whole organism decreased size, abnormal	AB + MO1-pnpo	Figure 5 from Chen et al., 2019
whole organism viability, abnormal	AB + MO1-pnpo	Figure 6 from Chen et al., 2019

Phenotype of all Fish created by or utilizing MO1-pnpo

Phenotype	Fish	Conditions	Figures
whole organism pnpo expression decreased amount, abnormal	AB + MO1-pnpo	standard conditions	Figure 4 from Chen et al., 2019
heart morphology, ameliorated	AB + MO1-pnpo	chemical treatment by environment: pyridoxal 5'-phosphate	Figure 6 from Chen et al., 2019
swimming behavior process quality, ameliorated	AB + MO1-pnpo	chemical treatment by environment: pyridoxal 5'-phosphate	Figure 8 from Chen et al., 2019
whole organism viability, abnormal	AB + MO1-pnpo	chemical treatment by environment: pyridoxine	Figure 6 from Chen et al., 2019
trunk morphology, abnormal	AB + MO1-pnpo	chemical treatment by environment: pyridoxine	Figure 6 from Chen et al., 2019
eye morphology, ameliorated	AB + MO1-pnpo	chemical treatment by environment: pyridoxamine	Figure 6 from Chen et al., 2019
brain morphology, abnormal	AB + MO1-pnpo	standard conditions	Figure 6 from Chen et al., 2019
swimming behavior process quality, ameliorated	AB + MO1-pnpo	chemical treatment by environment: pyridoxamine	Figure 8 from Chen et al., 2019
swim bladder malformed, abnormal	AB + MO1-pnpo	chemical treatment by environment: pyridoxine	Figure 6 from Chen et al., 2019
locomotory behavior process quality, ameliorated	AB + MO1-pnpo	chemical treatment by environment: gamma-aminobutyric acid	Figure 7 from Chen et al., 2019
eye morphology, abnormal	AB + MO1-pnpo	chemical treatment by environment: pyridoxal	Figure 6 from Chen et al., 2019
whole organism viability, ameliorated	AB + MO1-pnpo	chemical treatment by environment: pyridoxal 5'-phosphate	Figure 6 from Chen et al., 2019
whole organism viability, ameliorated	AB + MO1-pnpo	chemical treatment by environment: pyridoxamine	Figure 6 from Chen et al., 2019
locomotory behavior process quality, ameliorated	AB + MO1-pnpo	chemical treatment by environment: pyridoxal	Figure 7 from Chen et al., 2019
heart morphology, abnormal	AB + MO1-pnpo	chemical treatment by environment: pyridoxamine	Figure 6 from Chen et al., 2019
locomotory behavior process quality, ameliorated	AB + MO1-pnpo	chemical treatment by environment: pyridoxal 5'-phosphate	Figure 7 from Chen et al., 2019
locomotory behavior process quality, ameliorated	AB + MO1-pnpo	chemical treatment by environment: pyridoxine	Figure 7 from Chen et al., 2019
brain morphology, abnormal	AB + MO1-pnpo	chemical treatment by environment: pyridoxal	Figure 6 from Chen et al., 2019
trunk curved ventral, abnormal	AB + MO1-pnpo	standard conditions	Figure 5 from Chen et al., 2019
swimming behavior decreased process quality, abnormal	AB + MO1-pnpo	chemical treatment by environment: pyridoxine	Figure 8 from Chen et al., 2019
eye morphology, ameliorated	AB + MO1-pnpo	chemical treatment by environment: pyridoxal 5'-phosphate	Figure 6 from Chen et al., 2019
ventricular system development disrupted, abnormal	AB + MO1-pnpo	standard conditions	Figure 5 from Chen et al., 2019
swim bladder morphology, ameliorated	AB + MO1-pnpo	chemical treatment by environment: pyridoxal	Figure 6 from Chen et al., 2019
heart morphology, abnormal	AB + MO1-pnpo	chemical treatment by environment: pyridoxal	Figure 6 from Chen et al., 2019
third ventricle morphology, abnormal	AB + MO1-pnpo	standard conditions	Figure 5 from Chen et al., 2019
trunk morphology, abnormal	AB + MO1-pnpo	standard conditions	Figure 6 from Chen et al., 2019
trunk malformed, abnormal	AB + MO1-pnpo	standard conditions	Figure 5 from Chen et al., 2019
whole organism decreased size, abnormal	AB + MO1-pnpo	standard conditions	Figure 5 from Chen et al., 2019
swim bladder morphology, ameliorated	AB + MO1-pnpo	chemical treatment by environment: pyridoxamine	Figure 6 from Chen et al., 2019
swim bladder malformed, abnormal	AB + MO1-pnpo	standard conditions	Figure 6 from Chen et al., 2019
swim bladder morphology, ameliorated	AB + MO1-pnpo	chemical treatment by environment: pyridoxal 5'-phosphate	Figure 6 from Chen et al., 2019
eye decreased size, abnormal	AB + MO1-pnpo	standard conditions	Figure 6 from Chen et al., 2019
brain morphology, ameliorated	AB + MO1-pnpo	chemical treatment by environment: pyridoxamine	Figure 6 from Chen et al., 2019
third ventricle open, abnormal	AB + MO1-pnpo	standard conditions	Figure 5 from Chen et al., 2019
brain morphology, abnormal	AB + MO1-pnpo	chemical treatment by environment: pyridoxal 5'-phosphate	Figure 6 from Chen et al., 2019
heart morphology, abnormal	AB + MO1-pnpo	standard conditions	Figure 6 from Chen et al., 2019
somite cuboid, abnormal	AB + MO1-pnpo	standard conditions	Figure 5 from Chen et al., 2019
brain structure, cavities, abnormal	AB + MO1-pnpo	standard conditions	Figure 5 from Chen et al., 2019
locomotory behavior process quality, ameliorated	AB + MO1-pnpo	chemical treatment by environment: pyridoxamine	Figure 7 from Chen et al., 2019
trunk morphology, abnormal	AB + MO1-pnpo	chemical treatment by environment: pyridoxal 5'-phosphate	Figure 6 from Chen et al., 2019
heart morphology, abnormal	AB + MO1-pnpo	chemical treatment by environment: pyridoxine	Figure 6 from Chen et al., 2019
eye morphology, abnormal	AB + MO1-pnpo	chemical treatment by environment: pyridoxine	Figure 6 from Chen et al., 2019
caudal fin malformed, abnormal	AB + MO1-pnpo	standard conditions	Figure 5 from Chen et al., 2019
locomotory behavior increased process quality, abnormal	AB + MO1-pnpo	standard conditions	Figure 7 from Chen et al., 2019
neural tube closure arrested, abnormal	AB + MO1-pnpo	standard conditions	Figure 5 from Chen et al., 2019
whole organism viability, abnormal	AB + MO1-pnpo	standard conditions	Figure 6 from Chen et al., 2019
swimming behavior decreased process quality, abnormal	AB + MO1-pnpo	chemical treatment by environment: pyridoxal	Figure 8 from Chen et al., 2019
whole organism viability, ameliorated	AB + MO1-pnpo	chemical treatment by environment: pyridoxal	Figure 6 from Chen et al., 2019
swimming behavior decreased process quality, abnormal	AB + MO1-pnpo	standard conditions	Figure 8 from Chen et al., 2019
brain morphology, abnormal	AB + MO1-pnpo	chemical treatment by environment: pyridoxine	Figure 6 from Chen et al., 2019
blood circulation disrupted, abnormal	hn1Tg + MO1-pnpo	standard conditions	text only from Chen et al., 2019
atrium position, abnormal	hn1Tg + MO1-pnpo	standard conditions	Figure 5 from Chen et al., 2019
heart looping disrupted, abnormal	hn1Tg + MO1-pnpo	standard conditions	Figure 5 from Chen et al., 2019
heart linear, abnormal	hn1Tg + MO1-pnpo	standard conditions	Figure 5 from Chen et al., 2019
cardiac ventricle position, abnormal	hn1Tg + MO1-pnpo	standard conditions	Figure 5 from Chen et al., 2019
neural crest cell migration disrupted, abnormal	nz4Tg + MO1-pnpo	standard conditions	Figure 5 from Chen et al., 2019
neural crest cell mislocalised, abnormal	nz4Tg + MO1-pnpo	standard conditions	Figure 5 from Chen et al., 2019
midbrain hindbrain boundary pax2a expression decreased amount, abnormal	nz4Tg + MO1-pnpo	standard conditions	Figure 5 from Chen et al., 2019

Citations