Morpholino

MO1-pnpo

ID
ZDB-MRPHLNO-200506-1
Name
MO1-pnpo
Previous Names
None
Target
Sequence
5' - ACGTCTCATGCTTGTTCCGCG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-pnpo
Expressed Gene Anatomy Figures
pax2a Figure 5 with image from Chen et al., 2019
pnpo Figure 4 with image from Chen et al., 2019
Phenotype
Phenotype resulting from MO1-pnpo
Phenotype Fish Figures
atrium position, abnormal hn1Tg + MO1-pnpo Figure 5 with image from Chen et al., 2019
blood circulation disrupted, abnormal hn1Tg + MO1-pnpo text only from Chen et al., 2019
brain morphology, abnormal AB + MO1-pnpo Figure 6 with image from Chen et al., 2019
brain structure, cavities, abnormal AB + MO1-pnpo Figure 5 with image from Chen et al., 2019
cardiac ventricle position, abnormal hn1Tg + MO1-pnpo Figure 5 with image from Chen et al., 2019
caudal fin malformed, abnormal AB + MO1-pnpo Figure 5 with image from Chen et al., 2019
eye decreased size, abnormal AB + MO1-pnpo Figure 6 with image from Chen et al., 2019
heart linear, abnormal hn1Tg + MO1-pnpo Figure 5 with image from Chen et al., 2019
heart morphology, abnormal AB + MO1-pnpo Figure 6 with image from Chen et al., 2019
heart looping disrupted, abnormal hn1Tg + MO1-pnpo Figure 5 with image from Chen et al., 2019
locomotory behavior increased process quality, abnormal AB + MO1-pnpo Figure 7 with image from Chen et al., 2019
midbrain hindbrain boundary pax2a expression decreased amount, abnormal nz4Tg + MO1-pnpo Figure 5 with image from Chen et al., 2019
neural crest cell mislocalised, abnormal nz4Tg + MO1-pnpo Figure 5 with image from Chen et al., 2019
neural crest cell migration disrupted, abnormal nz4Tg + MO1-pnpo Figure 5 with image from Chen et al., 2019
neural tube closure arrested, abnormal AB + MO1-pnpo Figure 5 with image from Chen et al., 2019
somite cuboid, abnormal AB + MO1-pnpo Figure 5 with image from Chen et al., 2019
swim bladder malformed, abnormal AB + MO1-pnpo Figure 6 with image from Chen et al., 2019
swimming behavior decreased process quality, abnormal AB + MO1-pnpo Figure 8 with image from Chen et al., 2019
third ventricle morphology, abnormal AB + MO1-pnpo Figure 5 with image from Chen et al., 2019
third ventricle open, abnormal AB + MO1-pnpo Figure 5 with image from Chen et al., 2019
trunk curved ventral, abnormal AB + MO1-pnpo Figure 5 with image from Chen et al., 2019
trunk malformed, abnormal AB + MO1-pnpo Figure 5 with image from Chen et al., 2019
trunk morphology, abnormal AB + MO1-pnpo Figure 6 with image from Chen et al., 2019
ventricular system development disrupted, abnormal AB + MO1-pnpo Figure 5 with image from Chen et al., 2019
whole organism pnpo expression decreased amount, abnormal AB + MO1-pnpo Figure 4 with image from Chen et al., 2019
whole organism decreased size, abnormal AB + MO1-pnpo Figure 5 with image from Chen et al., 2019
whole organism viability, abnormal AB + MO1-pnpo Figure 6 with image from Chen et al., 2019
Phenotype of all Fish created by or utilizing MO1-pnpo
Phenotype Fish Conditions Figures
whole organism pnpo expression decreased amount, abnormal AB + MO1-pnpo standard conditions Figure 4 with image from Chen et al., 2019
heart morphology, ameliorated AB + MO1-pnpo chemical treatment by environment: pyridoxal 5'-phosphate Figure 6 with image from Chen et al., 2019
swimming behavior process quality, ameliorated AB + MO1-pnpo chemical treatment by environment: pyridoxal 5'-phosphate Figure 8 with image from Chen et al., 2019
whole organism viability, abnormal AB + MO1-pnpo chemical treatment by environment: pyridoxine Figure 6 with image from Chen et al., 2019
trunk morphology, abnormal AB + MO1-pnpo chemical treatment by environment: pyridoxine Figure 6 with image from Chen et al., 2019
eye morphology, ameliorated AB + MO1-pnpo chemical treatment by environment: pyridoxamine Figure 6 with image from Chen et al., 2019
brain morphology, abnormal AB + MO1-pnpo standard conditions Figure 6 with image from Chen et al., 2019
swimming behavior process quality, ameliorated AB + MO1-pnpo chemical treatment by environment: pyridoxamine Figure 8 with image from Chen et al., 2019
swim bladder malformed, abnormal AB + MO1-pnpo chemical treatment by environment: pyridoxine Figure 6 with image from Chen et al., 2019
locomotory behavior process quality, ameliorated AB + MO1-pnpo chemical treatment by environment: gamma-aminobutyric acid Figure 7 with image from Chen et al., 2019
eye morphology, abnormal AB + MO1-pnpo chemical treatment by environment: pyridoxal Figure 6 with image from Chen et al., 2019
whole organism viability, ameliorated AB + MO1-pnpo chemical treatment by environment: pyridoxal 5'-phosphate Figure 6 with image from Chen et al., 2019
whole organism viability, ameliorated AB + MO1-pnpo chemical treatment by environment: pyridoxamine Figure 6 with image from Chen et al., 2019
locomotory behavior process quality, ameliorated AB + MO1-pnpo chemical treatment by environment: pyridoxal Figure 7 with image from Chen et al., 2019
heart morphology, abnormal AB + MO1-pnpo chemical treatment by environment: pyridoxamine Figure 6 with image from Chen et al., 2019
locomotory behavior process quality, ameliorated AB + MO1-pnpo chemical treatment by environment: pyridoxal 5'-phosphate Figure 7 with image from Chen et al., 2019
locomotory behavior process quality, ameliorated AB + MO1-pnpo chemical treatment by environment: pyridoxine Figure 7 with image from Chen et al., 2019
brain morphology, abnormal AB + MO1-pnpo chemical treatment by environment: pyridoxal Figure 6 with image from Chen et al., 2019
trunk curved ventral, abnormal AB + MO1-pnpo standard conditions Figure 5 with image from Chen et al., 2019
swimming behavior decreased process quality, abnormal AB + MO1-pnpo chemical treatment by environment: pyridoxine Figure 8 with image from Chen et al., 2019
eye morphology, ameliorated AB + MO1-pnpo chemical treatment by environment: pyridoxal 5'-phosphate Figure 6 with image from Chen et al., 2019
ventricular system development disrupted, abnormal AB + MO1-pnpo standard conditions Figure 5 with image from Chen et al., 2019
swim bladder morphology, ameliorated AB + MO1-pnpo chemical treatment by environment: pyridoxal Figure 6 with image from Chen et al., 2019
heart morphology, abnormal AB + MO1-pnpo chemical treatment by environment: pyridoxal Figure 6 with image from Chen et al., 2019
third ventricle morphology, abnormal AB + MO1-pnpo standard conditions Figure 5 with image from Chen et al., 2019
trunk morphology, abnormal AB + MO1-pnpo standard conditions Figure 6 with image from Chen et al., 2019
trunk malformed, abnormal AB + MO1-pnpo standard conditions Figure 5 with image from Chen et al., 2019
whole organism decreased size, abnormal AB + MO1-pnpo standard conditions Figure 5 with image from Chen et al., 2019
swim bladder morphology, ameliorated AB + MO1-pnpo chemical treatment by environment: pyridoxamine Figure 6 with image from Chen et al., 2019
swim bladder malformed, abnormal AB + MO1-pnpo standard conditions Figure 6 with image from Chen et al., 2019
swim bladder morphology, ameliorated AB + MO1-pnpo chemical treatment by environment: pyridoxal 5'-phosphate Figure 6 with image from Chen et al., 2019
eye decreased size, abnormal AB + MO1-pnpo standard conditions Figure 6 with image from Chen et al., 2019
brain morphology, ameliorated AB + MO1-pnpo chemical treatment by environment: pyridoxamine Figure 6 with image from Chen et al., 2019
third ventricle open, abnormal AB + MO1-pnpo standard conditions Figure 5 with image from Chen et al., 2019
brain morphology, abnormal AB + MO1-pnpo chemical treatment by environment: pyridoxal 5'-phosphate Figure 6 with image from Chen et al., 2019
heart morphology, abnormal AB + MO1-pnpo standard conditions Figure 6 with image from Chen et al., 2019
somite cuboid, abnormal AB + MO1-pnpo standard conditions Figure 5 with image from Chen et al., 2019
brain structure, cavities, abnormal AB + MO1-pnpo standard conditions Figure 5 with image from Chen et al., 2019
locomotory behavior process quality, ameliorated AB + MO1-pnpo chemical treatment by environment: pyridoxamine Figure 7 with image from Chen et al., 2019
trunk morphology, abnormal AB + MO1-pnpo chemical treatment by environment: pyridoxal 5'-phosphate Figure 6 with image from Chen et al., 2019
heart morphology, abnormal AB + MO1-pnpo chemical treatment by environment: pyridoxine Figure 6 with image from Chen et al., 2019
eye morphology, abnormal AB + MO1-pnpo chemical treatment by environment: pyridoxine Figure 6 with image from Chen et al., 2019
caudal fin malformed, abnormal AB + MO1-pnpo standard conditions Figure 5 with image from Chen et al., 2019
locomotory behavior increased process quality, abnormal AB + MO1-pnpo standard conditions Figure 7 with image from Chen et al., 2019
neural tube closure arrested, abnormal AB + MO1-pnpo standard conditions Figure 5 with image from Chen et al., 2019
whole organism viability, abnormal AB + MO1-pnpo standard conditions Figure 6 with image from Chen et al., 2019
swimming behavior decreased process quality, abnormal AB + MO1-pnpo chemical treatment by environment: pyridoxal Figure 8 with image from Chen et al., 2019
whole organism viability, ameliorated AB + MO1-pnpo chemical treatment by environment: pyridoxal Figure 6 with image from Chen et al., 2019
swimming behavior decreased process quality, abnormal AB + MO1-pnpo standard conditions Figure 8 with image from Chen et al., 2019
brain morphology, abnormal AB + MO1-pnpo chemical treatment by environment: pyridoxine Figure 6 with image from Chen et al., 2019
blood circulation disrupted, abnormal hn1Tg + MO1-pnpo standard conditions text only from Chen et al., 2019
atrium position, abnormal hn1Tg + MO1-pnpo standard conditions Figure 5 with image from Chen et al., 2019
heart looping disrupted, abnormal hn1Tg + MO1-pnpo standard conditions Figure 5 with image from Chen et al., 2019
heart linear, abnormal hn1Tg + MO1-pnpo standard conditions Figure 5 with image from Chen et al., 2019
cardiac ventricle position, abnormal hn1Tg + MO1-pnpo standard conditions Figure 5 with image from Chen et al., 2019
neural crest cell migration disrupted, abnormal nz4Tg + MO1-pnpo standard conditions Figure 5 with image from Chen et al., 2019
neural crest cell mislocalised, abnormal nz4Tg + MO1-pnpo standard conditions Figure 5 with image from Chen et al., 2019
midbrain hindbrain boundary pax2a expression decreased amount, abnormal nz4Tg + MO1-pnpo standard conditions Figure 5 with image from Chen et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.