Morpholino
MO2-wdr1
- ID
- ZDB-MRPHLNO-200407-4
- Name
- MO2-wdr1
- Previous Names
-
- E4 (1)
- Target
- Sequence
-
5' - GTCCAGCAGCGGTCACTCACTTCTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-wdr1
No data available
Phenotype
Phenotype resulting from MO2-wdr1
Phenotype of all Fish created by or utilizing MO2-wdr1
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| whole organism posterior side lacks parts or has fewer parts of type neutrophil, abnormal | WT + MO2-wdr1 | control |
Fig. 1
from Bowes et al., 2019 |
Citations