Morpholino

MO1-rab35b

ID

ZDB-MRPHLNO-200402-1

Name

MO1-rab35b

Previous Names

None

Target

Sequence

5' - TGCAGCTTCACGCCTCTCTCCAGCA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-rab35b

Expressed Gene	Anatomy	Figures
dand5	Kupffer's vesicle anatomical region	Fig. 4 from Kuhns et al., 2019
rab35b	whole organism	Fig. 4 from Kuhns et al., 2019

Phenotype

Phenotype resulting from MO1-rab35b

Phenotype	Fish	Figures
determination of heart left/right asymmetry disrupted, abnormal	WT + MO1-rab35b	Fig. 4 from Kuhns et al., 2019
determination of liver left/right asymmetry disrupted, abnormal	WT + MO1-rab35b	Fig. 4 from Kuhns et al., 2019
heart heterotaxic, abnormal	WT + MO1-rab35b	Fig. 4 from Kuhns et al., 2019
heart position, abnormal	WT + MO1-rab35b	Fig. 4 from Kuhns et al., 2019
Kupffer's vesicle anatomical region dand5 expression spatial pattern, abnormal	WT + MO1-rab35b	Fig. 4 from Kuhns et al., 2019
Kupffer's vesicle cilium decreased length, abnormal	WT + MO1-rab35b	Fig. 4 from Kuhns et al., 2019
liver heterotaxic, abnormal	WT + MO1-rab35b	Fig. 4 from Kuhns et al., 2019
liver position, abnormal	WT + MO1-rab35b	Fig. 4 from Kuhns et al., 2019
pericardium edematous, abnormal	WT + MO1-rab35b	Fig. EV3 from Kuhns et al., 2019
whole organism rab35b expression decreased amount, abnormal	WT + MO1-rab35b	Fig. 4 from Kuhns et al., 2019

Phenotype of all Fish created by or utilizing MO1-rab35b

Phenotype	Fish	Conditions	Figures
pericardium edematous, abnormal	WT + MO1-rab35b	standard conditions	Fig. EV3 from Kuhns et al., 2019
determination of liver left/right asymmetry disrupted, abnormal	WT + MO1-rab35b	standard conditions	Fig. 4 from Kuhns et al., 2019
whole organism rab35b expression decreased amount, abnormal	WT + MO1-rab35b	standard conditions	Fig. 4 from Kuhns et al., 2019
determination of heart left/right asymmetry disrupted, abnormal	WT + MO1-rab35b	standard conditions	Fig. 4 from Kuhns et al., 2019
heart heterotaxic, abnormal	WT + MO1-rab35b	standard conditions	Fig. 4 from Kuhns et al., 2019
Kupffer's vesicle anatomical region dand5 expression spatial pattern, abnormal	WT + MO1-rab35b	standard conditions	Fig. 4 from Kuhns et al., 2019
Kupffer's vesicle cilium decreased length, abnormal	WT + MO1-rab35b	standard conditions	Fig. 4 from Kuhns et al., 2019
liver position, abnormal	WT + MO1-rab35b	standard conditions	Fig. 4 from Kuhns et al., 2019
heart position, abnormal	WT + MO1-rab35b	standard conditions	Fig. 4 from Kuhns et al., 2019
liver heterotaxic, abnormal	WT + MO1-rab35b	standard conditions	Fig. 4 from Kuhns et al., 2019

Citations