Morpholino

MO1-apela

ID
ZDB-MRPHLNO-191209-4
Name
MO1-apela
Previous Names
None
Target
Sequence
5' - TGGAAGAATCTCATGGTGATGCTCA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-apela
Phenotype
Phenotype resulting from MO1-apela
Phenotype Fish Figures
determination of left/right asymmetry in lateral mesoderm decreased occurrence, abnormal AB + MO1-apela Fig. 6 with image from Zhu et al., 2019
determination of liver left/right asymmetry decreased occurrence, abnormal AB + MO1-apela Fig. 5\ with image from Zhu et al., 2019
determination of liver left/right asymmetry process quality, abnormal as3Tg + MO1-apela Fig. 5\ with image from Zhu et al., 2019
forerunner cell group foxj1a expression decreased amount, abnormal AB + MO1-apela Fig. 7 with image from Zhu et al., 2019
forerunner cell group sox17 expression decreased distribution, abnormal AB + MO1-apela Fig. 4 with image from Zhu et al., 2019
heart cell decreased amount, abnormal twu34Tg + MO1-apela Fig. S9 with image from Zhu et al., 2019
heart primordium lft2 expression absent, abnormal AB + MO1-apela Fig. 6 with image from Zhu et al., 2019
heart primordium right side lft2 expression mislocalised, abnormal AB + MO1-apela Fig. 6 with image from Zhu et al., 2019
Kupffer's vesicle absent, abnormal AB + MO1-apela Fig. 3Fig. 6 with image from Zhu et al., 2019
Kupffer's vesicle decreased size, abnormal AB + MO1-apela Fig. 3Fig. 6 with image from Zhu et al., 2019
Kupffer's vesicle etv5b expression increased amount, abnormal AB + MO1-apela Fig. 7 with image from Zhu et al., 2019
lateral plate mesoderm spaw expression absent, abnormal AB + MO1-apela Fig. 6 with image from Zhu et al., 2019
lateral plate mesoderm right side spaw expression mislocalised, abnormal AB + MO1-apela Fig. 6 with image from Zhu et al., 2019
telencephalon determination of left/right asymmetry in nervous system decreased process quality, abnormal AB + MO1-apela Fig. 5\ with image from Zhu et al., 2019
telencephalon lateral side otx5 expression mislocalised, abnormal AB + MO1-apela Fig. 5\ with image from Zhu et al., 2019
trunk medial region lft1 expression decreased amount, abnormal AB + MO1-apela Fig. 8 with image from Zhu et al., 2019
whole organism foxj1a expression decreased amount, abnormal AB + MO1-apela Fig. 7 with image from Zhu et al., 2019
whole organism morphology, abnormal twu34Tg + MO1-apela Fig. S9 with image from Zhu et al., 2019
Phenotype of all Fish created by or utilizing MO1-apela
Phenotype Fish Conditions Figures
whole organism morphology, abnormal AB + MO1-apela standard conditions Fig. S9 with image from Zhu et al., 2019
lateral plate mesoderm spaw expression absent, abnormal AB + MO1-apela standard conditions Fig. 6 with image from Zhu et al., 2019
heart primordium lft2 expression absent, abnormal AB + MO1-apela standard conditions Fig. 6 with image from Zhu et al., 2019
forerunner cell group sox17 expression decreased distribution, abnormal AB + MO1-apela standard conditions Fig. 4 with image from Zhu et al., 2019
heart primordium right side lft2 expression mislocalised, abnormal AB + MO1-apela standard conditions Fig. 6 with image from Zhu et al., 2019
lateral plate mesoderm right side spaw expression mislocalised, abnormal AB + MO1-apela standard conditions Fig. 6 with image from Zhu et al., 2019
whole organism foxj1a expression decreased amount, abnormal AB + MO1-apela standard conditions Fig. 7 with image from Zhu et al., 2019
telencephalon lateral side otx5 expression mislocalised, abnormal AB + MO1-apela standard conditions Fig. 5\ with image from Zhu et al., 2019
Kupffer's vesicle etv5b expression increased amount, abnormal AB + MO1-apela standard conditions Fig. 7 with image from Zhu et al., 2019
determination of left/right asymmetry in lateral mesoderm decreased occurrence, abnormal AB + MO1-apela standard conditions Fig. 6 with image from Zhu et al., 2019
telencephalon determination of left/right asymmetry in nervous system decreased process quality, abnormal AB + MO1-apela standard conditions Fig. 5\ with image from Zhu et al., 2019
determination of liver left/right asymmetry decreased occurrence, abnormal AB + MO1-apela standard conditions Fig. 5\ with image from Zhu et al., 2019
determination of liver left/right asymmetry process quality, abnormal AB + MO1-apela standard conditions Fig. 5\ with image from Zhu et al., 2019
trunk medial region lft1 expression decreased amount, abnormal AB + MO1-apela standard conditions Fig. 8 with image from Zhu et al., 2019
forerunner cell group foxj1a expression decreased amount, abnormal AB + MO1-apela standard conditions Fig. 7 with image from Zhu et al., 2019
Kupffer's vesicle absent, abnormal AB + MO1-apela standard conditions Fig. 3Fig. 6 with image from Zhu et al., 2019
Kupffer's vesicle decreased size, abnormal AB + MO1-apela standard conditions Fig. 3Fig. 6 with image from Zhu et al., 2019
determination of liver left/right asymmetry decreased occurrence, abnormal as3Tg + MO1-apela standard conditions Fig. 5\ with image from Zhu et al., 2019
determination of liver left/right asymmetry process quality, abnormal as3Tg + MO1-apela standard conditions Fig. 5\ with image from Zhu et al., 2019
heart cell decreased amount, abnormal twu34Tg + MO1-apela standard conditions Fig. S9 with image from Zhu et al., 2019
whole organism morphology, abnormal twu34Tg + MO1-apela standard conditions Fig. S9 with image from Zhu et al., 2019
determination of liver left/right asymmetry decreased occurrence, abnormal AB + MO1-apela + MO1-aplnra standard conditions Fig. 5\ with image from Zhu et al., 2019
determination of liver left/right asymmetry process quality, abnormal AB + MO1-apela + MO1-aplnra standard conditions Fig. 5\ with image from Zhu et al., 2019
determination of liver left/right asymmetry decreased occurrence, abnormal AB + MO1-apela + MO1-aplnrb standard conditions Fig. 5\ with image from Zhu et al., 2019
determination of liver left/right asymmetry process quality, abnormal AB + MO1-apela + MO1-aplnrb standard conditions Fig. 5\ with image from Zhu et al., 2019
Citations