Morpholino
MO1-eif4e2
- ID
- ZDB-MRPHLNO-190924-5
- Name
- MO1-eif4e2
- Previous Names
-
- Mo1-eif4e2
- Target
- Sequence
-
5' - GCGTGTGTGTAGGTTACCGAAGCAA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-eif4e2
No data available
Phenotype
Phenotype resulting from MO1-eif4e2
Phenotype of all Fish created by or utilizing MO1-eif4e2
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| intersegmental vessel angiogenesis decreased occurrence, abnormal | s843Tg + MO1-eif4e2 | control |
Fig. S7 |
| intersegmental vessel malformed, abnormal | s843Tg + MO1-eif4e2 | control |
Fig. S7 |
| central artery angiogenesis decreased occurrence, abnormal | s843Tg + MO1-eif4e2 | control |
Fig. 5 |
| central artery decreased branchiness, abnormal | s843Tg + MO1-eif4e2 | control |
Fig. 5 |
| central artery decreased length, abnormal | s843Tg + MO1-eif4e2 | control |
Fig. 5 |
Citations