Morpholino
MO1-chst14
- ID
- ZDB-MRPHLNO-190828-1
- Name
- MO1-chst14
- Previous Names
- None
- Target
- Sequence
-
5' - CATTAAAGATGTCTGTTTACTGAGG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
The author was contacted and provided this corrected MO sequence.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-chst14
No data available
Phenotype
Phenotype resulting from MO1-chst14
No data available
Phenotype of all Fish created by or utilizing MO1-chst14
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| locomotory behavior decreased efficacy, abnormal | WT + MO1-chst14 | transection: spinal cord |
Fig. 1,
Fig. 5
from Sahu et al., 2018 |
Citations