Morpholino

MO1-clcn7

ID
ZDB-MRPHLNO-190823-1
Name
MO1-clcn7
Previous Names
  • tbMO (1)
Target
Sequence
5' - CCTGCTAAGCAGAGAACTACTGCGT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-clcn7
Expressed Gene Anatomy Figures
bmp2b Fig. 6 with image from Zhang et al., 2019
bmpr1aa Fig. 6 with image from Zhang et al., 2019
bmpr1ab Fig. 6 with image from Zhang et al., 2019
bmpr1ba Fig. 6 with image from Zhang et al., 2019
bmpr1bb Fig. 6 with image from Zhang et al., 2019
bmpr2a Fig. 6 with image from Zhang et al., 2019
bmpr2b Fig. 6 with image from Zhang et al., 2019
col10a1a Fig. 3 with image from Zhang et al., 2019
ctsk Fig. 6 with image from Zhang et al., 2019
dlx2b Fig. 4 with image from Zhang et al., 2019
eve1 Fig. 4 with image from Zhang et al., 2019
gja1b Fig. 4 with image from Zhang et al., 2019
sp7 Fig. 3 with image from Zhang et al., 2019
tgfb1a Fig. 6 with image from Zhang et al., 2019
tgfb1b Fig. 6 with image from Zhang et al., 2019
tgfbr1a Fig. 6 with image from Zhang et al., 2019
tgfbr1b Fig. 6 with image from Zhang et al., 2019
tgfbr2a Fig. 6 with image from Zhang et al., 2019
tgfbr2b Fig. 6 with image from Zhang et al., 2019
tgfbr3 Fig. 6 with image from Zhang et al., 2019
tgfbrap1 Fig. 6 with image from Zhang et al., 2019
Phenotype
Phenotype resulting from MO1-clcn7
Phenotype Fish Figures
ameloblast eve1 expression absent, abnormal AB + MO1-clcn7 Fig. 4 with image from Zhang et al., 2019
ameloblast gja1b expression decreased amount, abnormal AB + MO1-clcn7 Fig. 4 with image from Zhang et al., 2019
basihyal cartilage oblique orientation, abnormal AB + MO1-clcn7 Fig. 3 with image,  Fig. 7 with image from Zhang et al., 2019
ceratobranchial 5 bone lacks parts or has fewer parts of type tooth 5V, abnormal AB + MO1-clcn7 Fig. 4 with image from Zhang et al., 2019
ceratobranchial 5 bone lacks parts or has fewer parts of type tooth 4V, abnormal AB + MO1-clcn7 Fig. 4 with image,  Fig. 7 with image from Zhang et al., 2019
ceratobranchial 5 bone lacks parts or has fewer parts of type tooth 3V, abnormal AB + MO1-clcn7 Fig. 4 with image from Zhang et al., 2019
ceratobranchial 5 tooth composition, abnormal AB + MO1-clcn7 Fig. 4 with image from Zhang et al., 2019
ceratobranchial 5 tooth porous, abnormal AB + MO1-clcn7 Fig. 4 with image from Zhang et al., 2019
ceratobranchial 5 tooth rough, abnormal AB + MO1-clcn7 Fig. 4 with image from Zhang et al., 2019
ceratobranchial 5 tooth tooth mineralization decreased efficacy, abnormal AB + MO1-clcn7 Fig. 4 with image from Zhang et al., 2019
ceratohyal cartilage angle basihyal cartilage, abnormal AB + MO1-clcn7 Fig. 3 with image,  Fig. 7 with image from Zhang et al., 2019
ceratohyal cartilage decreased distance palatoquadrate cartilage, abnormal AB + MO1-clcn7 Fig. 3 with image from Zhang et al., 2019
ceratohyal cartilage decreased length, abnormal AB + MO1-clcn7 Fig. 3 with image from Zhang et al., 2019
ceratohyal cartilage increased variability of size, abnormal AB + MO1-clcn7 Fig. 3 with image from Zhang et al., 2019
cranial cartilage morphology, abnormal AB + MO1-clcn7 Fig. 3 with image from Zhang et al., 2019
dental epithelium dlx2b expression absent, abnormal AB + MO1-clcn7 Fig. 4 with image from Zhang et al., 2019
dental mesenchyme dlx2b expression absent, abnormal AB + MO1-clcn7 Fig. 4 with image from Zhang et al., 2019
head decreased size, abnormal AB + MO1-clcn7 Fig. 3 with image from Zhang et al., 2019
head decreased width, abnormal AB + MO1-clcn7 Fig. 3 with image from Zhang et al., 2019
head has extra parts of type brain lysosome, abnormal AB + MO1-clcn7 Fig. 6 with image from Zhang et al., 2019
head has extra parts of type pharyngeal arch 1 lysosome, abnormal AB + MO1-clcn7 Fig. 6 with image from Zhang et al., 2019
head has extra parts of type pharyngeal arch 1 late endosome, abnormal AB + MO1-clcn7 Fig. 6 with image from Zhang et al., 2019
head has extra parts of type brain late endosome, abnormal AB + MO1-clcn7 Fig. 6 with image from Zhang et al., 2019
head increased variability of size, abnormal AB + MO1-clcn7 Fig. 3 with image from Zhang et al., 2019
Meckel's cartilage increased distance ceratohyal cartilage, abnormal AB + MO1-clcn7 Fig. 3 with image from Zhang et al., 2019
odontoblast gja1b expression decreased amount, abnormal AB + MO1-clcn7 Fig. 4 with image from Zhang et al., 2019
opercle sp7 expression absent, abnormal AB + MO1-clcn7 Fig. 3 with image from Zhang et al., 2019
opercle col10a1a expression absent, abnormal AB + MO1-clcn7 Fig. 3 with image from Zhang et al., 2019
palatoquadrate cartilage decreased length, abnormal AB + MO1-clcn7 Fig. 3 with image from Zhang et al., 2019
palatoquadrate cartilage increased variability of size, abnormal AB + MO1-clcn7 Fig. 3 with image from Zhang et al., 2019
parasphenoid sp7 expression absent, abnormal AB + MO1-clcn7 Fig. 3 with image from Zhang et al., 2019
parasphenoid col10a1a expression absent, abnormal AB + MO1-clcn7 Fig. 3 with image from Zhang et al., 2019
pharyngeal arch 3-7 skeleton lacks parts or has fewer parts of type ceratobranchial cartilage, abnormal AB + MO1-clcn7 Fig. 3 with image from Zhang et al., 2019
whole organism bmpr2a expression absent, abnormal AB + MO1-clcn7 Fig. 6 with image from Zhang et al., 2019
whole organism bmp2b expression absent, abnormal AB + MO1-clcn7 Fig. 6 with image from Zhang et al., 2019
whole organism bmpr2b expression decreased amount, abnormal AB + MO1-clcn7 Fig. 6 with image from Zhang et al., 2019
whole organism Ab13-smad labeling decreased amount, abnormal AB + MO1-clcn7 Fig. 6 with image from Zhang et al., 2019
whole organism ctsk expression decreased amount, abnormal AB + MO1-clcn7 Fig. 6 with image from Zhang et al., 2019
whole organism tgfb1b expression decreased amount, abnormal AB + MO1-clcn7 Fig. 6 with image from Zhang et al., 2019
whole organism tgfbr1b expression decreased amount, abnormal AB + MO1-clcn7 Fig. 6 with image from Zhang et al., 2019
whole organism bmpr1bb expression decreased amount, abnormal AB + MO1-clcn7 Fig. 6 with image from Zhang et al., 2019
whole organism tgfbr2b expression decreased amount, abnormal AB + MO1-clcn7 Fig. 6 with image from Zhang et al., 2019
whole organism tgfb1a expression decreased amount, abnormal AB + MO1-clcn7 Fig. 6 with image from Zhang et al., 2019
whole organism bmpr1ba expression decreased amount, abnormal AB + MO1-clcn7 Fig. 6 with image from Zhang et al., 2019
whole organism decreased length, abnormal AB + MO1-clcn7 Fig. 3 with image from Zhang et al., 2019
whole organism Ab11-smad2 labeling increased amount, abnormal AB + MO1-clcn7 Fig. 6 with image from Zhang et al., 2019
whole organism tgfbr2a expression increased amount, abnormal AB + MO1-clcn7 Fig. 6 with image from Zhang et al., 2019
Phenotype of all Fish created by or utilizing MO1-clcn7
Phenotype Fish Conditions Figures
ceratohyal cartilage angle basihyal cartilage, ameliorated AB + MO1-clcn7 chemical treatment by environment: SB 431542 Fig. 7 with image from Zhang et al., 2019
ceratobranchial 5 tooth rough, abnormal AB + MO1-clcn7 standard conditions Fig. 4 with image from Zhang et al., 2019
basihyal cartilage oblique orientation, ameliorated AB + MO1-clcn7 chemical treatment by environment: SB 431542 Fig. 7 with image from Zhang et al., 2019
whole organism tgfbr1b expression decreased amount, abnormal AB + MO1-clcn7 standard conditions Fig. 6 with image from Zhang et al., 2019
head decreased size, abnormal AB + MO1-clcn7 standard conditions Fig. 3 with image from Zhang et al., 2019
head has extra parts of type pharyngeal arch 1 lysosome, abnormal AB + MO1-clcn7 standard conditions Fig. 6 with image from Zhang et al., 2019
Meckel's cartilage increased distance ceratohyal cartilage, abnormal AB + MO1-clcn7 standard conditions Fig. 3 with image from Zhang et al., 2019
ceratohyal cartilage decreased distance palatoquadrate cartilage, abnormal AB + MO1-clcn7 standard conditions Fig. 3 with image from Zhang et al., 2019
head decreased width, abnormal AB + MO1-clcn7 standard conditions Fig. 3 with image from Zhang et al., 2019
cranial cartilage morphology, abnormal AB + MO1-clcn7 standard conditions Fig. 3 with image from Zhang et al., 2019
basihyal cartilage oblique orientation, abnormal AB + MO1-clcn7 standard conditions Fig. 3 with image,  Fig. 7 with image from Zhang et al., 2019
whole organism bmpr2b expression decreased amount, abnormal AB + MO1-clcn7 standard conditions Fig. 6 with image from Zhang et al., 2019
ceratobranchial 5 bone lacks parts or has fewer parts of type tooth 5V, abnormal AB + MO1-clcn7 standard conditions Fig. 4 with image from Zhang et al., 2019
opercle sp7 expression absent, abnormal AB + MO1-clcn7 standard conditions Fig. 3 with image from Zhang et al., 2019
whole organism Ab11-smad2 labeling increased amount, abnormal AB + MO1-clcn7 standard conditions Fig. 6 with image from Zhang et al., 2019
ameloblast gja1b expression decreased amount, abnormal AB + MO1-clcn7 standard conditions Fig. 4 with image from Zhang et al., 2019
odontoblast gja1b expression decreased amount, abnormal AB + MO1-clcn7 standard conditions Fig. 4 with image from Zhang et al., 2019
palatoquadrate cartilage decreased length, abnormal AB + MO1-clcn7 standard conditions Fig. 3 with image from Zhang et al., 2019
opercle col10a1a expression absent, abnormal AB + MO1-clcn7 standard conditions Fig. 3 with image from Zhang et al., 2019
whole organism bmpr2a expression absent, abnormal AB + MO1-clcn7 standard conditions Fig. 6 with image from Zhang et al., 2019
palatoquadrate cartilage increased variability of size, abnormal AB + MO1-clcn7 standard conditions Fig. 3 with image from Zhang et al., 2019
head has extra parts of type pharyngeal arch 1 late endosome, abnormal AB + MO1-clcn7 standard conditions Fig. 6 with image from Zhang et al., 2019
ceratobranchial 5 bone lacks parts or has fewer parts of type tooth 4V, ameliorated AB + MO1-clcn7 chemical treatment by environment: SB 431542 Fig. 7 with image from Zhang et al., 2019
whole organism tgfb1b expression decreased amount, abnormal AB + MO1-clcn7 standard conditions Fig. 6 with image from Zhang et al., 2019
ceratobranchial 5 bone lacks parts or has fewer parts of type tooth 4V, abnormal AB + MO1-clcn7 standard conditions Fig. 4 with image,  Fig. 7 with image from Zhang et al., 2019
head has extra parts of type brain late endosome, abnormal AB + MO1-clcn7 standard conditions Fig. 6 with image from Zhang et al., 2019
ceratohyal cartilage angle basihyal cartilage, abnormal AB + MO1-clcn7 standard conditions Fig. 3 with image,  Fig. 7 with image from Zhang et al., 2019
pharyngeal arch 3-7 skeleton lacks parts or has fewer parts of type ceratobranchial cartilage, abnormal AB + MO1-clcn7 standard conditions Fig. 3 with image from Zhang et al., 2019
dental epithelium dlx2b expression absent, abnormal AB + MO1-clcn7 standard conditions Fig. 4 with image from Zhang et al., 2019
whole organism tgfbr2b expression decreased amount, abnormal AB + MO1-clcn7 standard conditions Fig. 6 with image from Zhang et al., 2019
whole organism bmpr1ba expression decreased amount, abnormal AB + MO1-clcn7 standard conditions Fig. 6 with image from Zhang et al., 2019
whole organism bmp2b expression absent, abnormal AB + MO1-clcn7 standard conditions Fig. 6 with image from Zhang et al., 2019
whole organism bmpr1bb expression decreased amount, abnormal AB + MO1-clcn7 standard conditions Fig. 6 with image from Zhang et al., 2019
whole organism ctsk expression decreased amount, abnormal AB + MO1-clcn7 standard conditions Fig. 6 with image from Zhang et al., 2019
head has extra parts of type brain lysosome, abnormal AB + MO1-clcn7 standard conditions Fig. 6 with image from Zhang et al., 2019
whole organism Ab13-smad labeling decreased amount, abnormal AB + MO1-clcn7 standard conditions Fig. 6 with image from Zhang et al., 2019
whole organism decreased length, abnormal AB + MO1-clcn7 standard conditions Fig. 3 with image from Zhang et al., 2019
ceratobranchial 5 tooth composition, abnormal AB + MO1-clcn7 standard conditions Fig. 4 with image from Zhang et al., 2019
whole organism tgfbr2a expression increased amount, abnormal AB + MO1-clcn7 standard conditions Fig. 6 with image from Zhang et al., 2019
ceratobranchial 5 tooth porous, abnormal AB + MO1-clcn7 standard conditions Fig. 4 with image from Zhang et al., 2019
ameloblast eve1 expression absent, abnormal AB + MO1-clcn7 standard conditions Fig. 4 with image from Zhang et al., 2019
ceratohyal cartilage decreased length, abnormal AB + MO1-clcn7 standard conditions Fig. 3 with image from Zhang et al., 2019
ceratobranchial 5 tooth tooth mineralization decreased efficacy, abnormal AB + MO1-clcn7 standard conditions Fig. 4 with image from Zhang et al., 2019
parasphenoid sp7 expression absent, abnormal AB + MO1-clcn7 standard conditions Fig. 3 with image from Zhang et al., 2019
whole organism tgfb1a expression decreased amount, abnormal AB + MO1-clcn7 standard conditions Fig. 6 with image from Zhang et al., 2019
ceratobranchial 5 bone lacks parts or has fewer parts of type tooth 3V, abnormal AB + MO1-clcn7 standard conditions Fig. 4 with image from Zhang et al., 2019
parasphenoid col10a1a expression absent, abnormal AB + MO1-clcn7 standard conditions Fig. 3 with image from Zhang et al., 2019
ceratohyal cartilage increased variability of size, abnormal AB + MO1-clcn7 standard conditions Fig. 3 with image from Zhang et al., 2019
dental mesenchyme dlx2b expression absent, abnormal AB + MO1-clcn7 standard conditions Fig. 4 with image from Zhang et al., 2019
head increased variability of size, abnormal AB + MO1-clcn7 standard conditions Fig. 3 with image from Zhang et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.