Morpholino

MO2-degs1

ID

ZDB-MRPHLNO-190819-2

Name

MO2-degs1

Previous Names

exon 2/intron 2 (1)

Target

degs1 (1)

Sequence

5' - GCTGAATAACTGCTCTCACCATTGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-degs1

No data available

Phenotype

Phenotype resulting from MO2-degs1

Phenotype	Fish	Figures
spinal cord oligodendrocyte EGFP expression decreased amount, abnormal	ck1Tg + MO2-degs1	Fig. 5 from Pant et al., 2019
spinal cord oligodendrocyte decreased amount, abnormal	ck1Tg + MO2-degs1	Fig. 5 from Pant et al., 2019
swimming behavior decreased process quality, abnormal	AB/TU + MO2-degs1	Fig. 5, Fig. 6 from Pant et al., 2019
whole organism decreased mobility, abnormal	AB/TU + MO2-degs1	Fig. 6 from Pant et al., 2019
whole organism morphology, abnormal	AB/TU + MO2-degs1	Fig. 5 from Pant et al., 2019
whole organism movement quality, abnormal	AB/TU + MO2-degs1	Fig. 5, Fig. 6 from Pant et al., 2019
whole organism dihydroceramide increased amount, abnormal	AB/TU + MO2-degs1	Fig. 5, Fig. 6 from Pant et al., 2019

Phenotype of all Fish created by or utilizing MO2-degs1

Phenotype	Fish	Conditions	Figures
swimming behavior decreased process quality, abnormal	AB/TU + MO2-degs1	standard conditions	Fig. 5, Fig. 6 from Pant et al., 2019
whole organism morphology, abnormal	AB/TU + MO2-degs1	standard conditions	Fig. 5 from Pant et al., 2019
whole organism mobility, ameliorated	AB/TU + MO2-degs1	chemical treatment by environment: fingolimod	Fig. 6 from Pant et al., 2019
whole organism dihydroceramide increased amount, abnormal	AB/TU + MO2-degs1	standard conditions	Fig. 5, Fig. 6 from Pant et al., 2019
whole organism dihydroceramide amount, ameliorated	AB/TU + MO2-degs1	chemical treatment by environment: fingolimod	Fig. 6 from Pant et al., 2019
swimming behavior process quality, ameliorated	AB/TU + MO2-degs1	chemical treatment by environment: fingolimod	Fig. 6 from Pant et al., 2019
whole organism decreased mobility, abnormal	AB/TU + MO2-degs1	standard conditions	Fig. 6 from Pant et al., 2019
whole organism movement quality, abnormal	AB/TU + MO2-degs1	standard conditions	Fig. 5, Fig. 6 from Pant et al., 2019
spinal cord oligodendrocyte EGFP expression decreased amount, abnormal	ck1Tg + MO2-degs1	standard conditions	Fig. 5 from Pant et al., 2019
spinal cord oligodendrocyte amount, ameliorated	ck1Tg + MO2-degs1	chemical treatment by environment: fingolimod	Fig. 5 from Pant et al., 2019
spinal cord oligodendrocyte decreased amount, abnormal	ck1Tg + MO2-degs1	standard conditions	Fig. 5 from Pant et al., 2019
spinal cord oligodendrocyte EGFP expression amount, ameliorated	ck1Tg + MO2-degs1	chemical treatment by environment: fingolimod	Fig. 5 from Pant et al., 2019

Citations