Morpholino
MO7-cftr
- ID
- ZDB-MRPHLNO-190805-1
- Name
- MO7-cftr
- Previous Names
- None
- Target
- Sequence
-
5' - GACACATTTTGGACACTCACACCAA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO7-cftr
No data available
Phenotype
Phenotype resulting from MO7-cftr
Phenotype | Fish | Figures |
---|---|---|
neutrophil increased amount, abnormal | i114Tg + MO7-cftr |
Fig. S3 ![]() |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO7-cftr
1 - 5 of 29 Show all
Citations
- Johansen, M.D., Alcaraz, M., Dedrick, R.M., Roquet-Banères, F., Hamela, C., Hatfull, G.F., Kremer, L. (2021) Mycobacteriophage-antibiotic therapy promotes enhanced clearance of drug-resistant Mycobacterium abscessus. Disease models & mechanisms. 14(9):
- Bernut, A., Loynes, C.A., Floto, R.A., Renshaw, S.A. (2020) Deletion of cftr Leads to an Excessive Neutrophilic Response and Defective Tissue Repair in a Zebrafish Model of Sterile Inflammation. Frontiers in immunology. 11:1733
- Johansen, M.D., Kremer, L. (2020) CFTR Depletion Confers Hypersusceptibility to Mycobacterium fortuitum in a Zebrafish Model. Frontiers in cellular and infection microbiology. 10:357
- Bernut, A., Dupont, C., Ogryzko, N.V., Neyret, A., Herrmann, J.L., Floto, R.A., Renshaw, S.A., Kremer, L. (2019) CFTR Protects against Mycobacterium abscessus Infection by Fine-Tuning Host Oxidative Defenses. Cell Reports. 26:1828-1840.e4
1 - 4 of 4
Show