Morpholino

MO1-fer1l6

ID
ZDB-MRPHLNO-190621-5
Name
MO1-fer1l6
Previous Names
None
Target
Sequence
5' - CTCCCTCTTCCTGACAAACATAAAA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-fer1l6
Phenotype
Phenotype resulting from MO1-fer1l6
Phenotype Fish Figures
cardiac chamber formation process quality, abnormal WT + MO1-fer1l6 Fig. 3 from Bonventre et al., 2018
head decreased size, abnormal WT + MO1-fer1l6 Fig. 2 from Bonventre et al., 2018
heart contraction decreased rate, abnormal WT + MO1-fer1l6 Fig. 3 from Bonventre et al., 2018
heart development delayed, abnormal WT + MO1-fer1l6 Fig. 3 from Bonventre et al., 2018
heart development process quality, abnormal WT + MO1-fer1l6 Fig. 3 from Bonventre et al., 2018
heart valve formation delayed, abnormal WT + MO1-fer1l6 Fig. 3 from Bonventre et al., 2018
muscle deformed, abnormal WT + MO1-fer1l6 Fig. 2 from Bonventre et al., 2018
myoseptum irregularly shaped, abnormal WT + MO1-fer1l6 Fig. 2 from Bonventre et al., 2018
myotome morphology, abnormal WT + MO1-fer1l6 Fig. 2 from Bonventre et al., 2018
myotome skeletal muscle myofibril bent, abnormal WT + MO1-fer1l6 Fig. 2 from Bonventre et al., 2018
pericardium edematous, abnormal WT + MO1-fer1l6 Fig. 2Fig. S3 from Bonventre et al., 2018
skeletal muscle malformed, abnormal WT + MO1-fer1l6 Fig. 3 from Bonventre et al., 2018
skeletal muscle A band disorganized, abnormal WT + MO1-fer1l6 Fig. 3 from Bonventre et al., 2018
skeletal muscle I band disorganized, abnormal WT + MO1-fer1l6 Fig. 3 from Bonventre et al., 2018
skeletal muscle sarcoplasmic reticulum disorganized, abnormal WT + MO1-fer1l6 Fig. 3 from Bonventre et al., 2018
spinal cord curvature, abnormal WT + MO1-fer1l6 Fig. 2Fig. S3 from Bonventre et al., 2018
trunk shortened, abnormal WT + MO1-fer1l6 Fig. 2 from Bonventre et al., 2018
whole organism pax7a expression decreased amount, abnormal WT + MO1-fer1l6 Fig. 4 from Bonventre et al., 2018
whole organism fer1l6 expression decreased amount, abnormal WT + MO1-fer1l6 Fig. 4 from Bonventre et al., 2018
whole organism fbxo32 expression decreased amount, abnormal WT + MO1-fer1l6 Fig. 4 from Bonventre et al., 2018
whole organism dysf expression increased amount, abnormal WT + MO1-fer1l6 Fig. 4 from Bonventre et al., 2018
whole organism trim63a expression increased amount, abnormal WT + MO1-fer1l6 Fig. 4 from Bonventre et al., 2018
whole organism myf6 expression increased amount, abnormal WT + MO1-fer1l6 Fig. 4 from Bonventre et al., 2018
whole organism myf5 expression increased amount, abnormal WT + MO1-fer1l6 Fig. 4 from Bonventre et al., 2018
whole organism myod1 expression increased amount, abnormal WT + MO1-fer1l6 Fig. 4 from Bonventre et al., 2018
whole organism myof expression increased amount, abnormal WT + MO1-fer1l6 Fig. 4 from Bonventre et al., 2018
yolk edematous, abnormal WT + MO1-fer1l6 Fig. S3 from Bonventre et al., 2018
Phenotype of all Fish created by or utilizing MO1-fer1l6
Phenotype Fish Conditions Figures
whole organism myod1 expression increased amount, abnormal WT + MO1-fer1l6 standard conditions Fig. 4 from Bonventre et al., 2018
heart development process quality, abnormal WT + MO1-fer1l6 standard conditions Fig. 3 from Bonventre et al., 2018
skeletal muscle A band disorganized, abnormal WT + MO1-fer1l6 standard conditions Fig. 3 from Bonventre et al., 2018
trunk shortened, abnormal WT + MO1-fer1l6 standard conditions Fig. 2 from Bonventre et al., 2018
heart valve formation delayed, abnormal WT + MO1-fer1l6 standard conditions Fig. 3 from Bonventre et al., 2018
muscle deformed, abnormal WT + MO1-fer1l6 standard conditions Fig. 2 from Bonventre et al., 2018
whole organism fbxo32 expression decreased amount, abnormal WT + MO1-fer1l6 standard conditions Fig. 4 from Bonventre et al., 2018
pericardium edematous, abnormal WT + MO1-fer1l6 standard conditions Fig. 2Fig. S3 from Bonventre et al., 2018
yolk edematous, abnormal WT + MO1-fer1l6 standard conditions Fig. S3 from Bonventre et al., 2018
myotome skeletal muscle myofibril bent, abnormal WT + MO1-fer1l6 standard conditions Fig. 2 from Bonventre et al., 2018
myotome morphology, abnormal WT + MO1-fer1l6 standard conditions Fig. 2 from Bonventre et al., 2018
spinal cord curvature, abnormal WT + MO1-fer1l6 standard conditions Fig. 2Fig. S3 from Bonventre et al., 2018
whole organism trim63a expression increased amount, abnormal WT + MO1-fer1l6 standard conditions Fig. 4 from Bonventre et al., 2018
head decreased size, abnormal WT + MO1-fer1l6 standard conditions Fig. 2 from Bonventre et al., 2018
whole organism pax7a expression decreased amount, abnormal WT + MO1-fer1l6 standard conditions Fig. 4 from Bonventre et al., 2018
skeletal muscle sarcoplasmic reticulum disorganized, abnormal WT + MO1-fer1l6 standard conditions Fig. 3 from Bonventre et al., 2018
whole organism myf5 expression increased amount, abnormal WT + MO1-fer1l6 standard conditions Fig. 4 from Bonventre et al., 2018
skeletal muscle I band disorganized, abnormal WT + MO1-fer1l6 standard conditions Fig. 3 from Bonventre et al., 2018
heart contraction decreased rate, abnormal WT + MO1-fer1l6 standard conditions Fig. 3 from Bonventre et al., 2018
whole organism myof expression increased amount, abnormal WT + MO1-fer1l6 standard conditions Fig. 4 from Bonventre et al., 2018
myoseptum irregularly shaped, abnormal WT + MO1-fer1l6 standard conditions Fig. 2 from Bonventre et al., 2018
whole organism fer1l6 expression decreased amount, abnormal WT + MO1-fer1l6 standard conditions Fig. 4 from Bonventre et al., 2018
cardiac chamber formation process quality, abnormal WT + MO1-fer1l6 standard conditions Fig. 3 from Bonventre et al., 2018
whole organism dysf expression increased amount, abnormal WT + MO1-fer1l6 standard conditions Fig. 4 from Bonventre et al., 2018
heart development delayed, abnormal WT + MO1-fer1l6 standard conditions Fig. 3 from Bonventre et al., 2018
whole organism myf6 expression increased amount, abnormal WT + MO1-fer1l6 standard conditions Fig. 4 from Bonventre et al., 2018
skeletal muscle malformed, abnormal WT + MO1-fer1l6 standard conditions Fig. 3 from Bonventre et al., 2018
Citations