Morpholino

MO3-dmrt2b

ID
ZDB-MRPHLNO-190514-1
Name
MO3-dmrt2b
Previous Names
None
Target
Sequence
5' - CTTTCTTACCCTGTTGATGAGAACA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-dmrt2b
Expressed Gene Anatomy Figures
bmper Fig. 5 with image from Li et al., 2018
cxcl12b Fig. 3 with image from Li et al., 2018
dmrt2b Fig. S2 from Li et al., 2018
hand2 Fig. 3 with image from Li et al., 2018
nkx2.3 Fig. 3 with image from Li et al., 2018
Phenotype
Phenotype resulting from MO3-dmrt2b
Phenotype Fish Figures
auditory capsule morphology, abnormal TU + MO3-dmrt2b Fig. 2 with image from Li et al., 2018
ceratobranchial 1 cartilage decreased size, abnormal TU + MO3-dmrt2b Fig. 2 with image from Li et al., 2018
ceratobranchial 1 cartilage morphology, abnormal TU + MO3-dmrt2b Fig. 2 with image from Li et al., 2018
ceratobranchial 2 cartilage decreased size, abnormal TU + MO3-dmrt2b Fig. 2 with image from Li et al., 2018
ceratobranchial 3 cartilage decreased size, abnormal TU + MO3-dmrt2b Fig. 2 with image from Li et al., 2018
ceratobranchial 3 cartilage morphology, abnormal TU + MO3-dmrt2b Fig. 2 with image from Li et al., 2018
ceratobranchial 4 cartilage decreased size, abnormal TU + MO3-dmrt2b Fig. 2 with image from Li et al., 2018
ceratobranchial 4 cartilage morphology, abnormal TU + MO3-dmrt2b Fig. 2 with image from Li et al., 2018
ceratobranchial 5 cartilage decreased size, abnormal TU + MO3-dmrt2b Fig. 2 with image from Li et al., 2018
ceratobranchial 5 cartilage morphology, abnormal TU + MO3-dmrt2b Fig. 2 with image from Li et al., 2018
ceratohyal cartilage decreased amount, abnormal y1Tg + MO3-dmrt2b Fig. 4 with image from Li et al., 2018
ceratohyal cartilage ab1-col2a labeling decreased amount, abnormal y1Tg + MO3-dmrt2b Fig. 4 with image from Li et al., 2018
ceratohyal cartilage decreased size, abnormal TU + MO3-dmrt2b Fig. 2 with image from Li et al., 2018
ceratohyal cartilage cranial neural crest EGFP expression decreased amount, abnormal y1Tg + MO3-dmrt2b Fig. S5 from Li et al., 2018
ethmoid cartilage morphology, abnormal TU + MO3-dmrt2b Fig. 2 with image from Li et al., 2018
head decreased size, abnormal TU + MO3-dmrt2b Fig. S2 from Li et al., 2018
hyosymplectic cartilage decreased size, abnormal TU + MO3-dmrt2b Fig. 2 with image from Li et al., 2018
hyosymplectic cartilage morphology, abnormal TU + MO3-dmrt2b Fig. 2 with image from Li et al., 2018
mandibular arch skeleton decreased size, abnormal TU + MO3-dmrt2b Fig. S2 from Li et al., 2018
mandibular arch skeleton morphology, abnormal TU + MO3-dmrt2b Fig. S2 from Li et al., 2018
Meckel's cartilage decreased size, abnormal TU + MO3-dmrt2b Fig. 2 with image from Li et al., 2018
Meckel's cartilage morphology, abnormal TU + MO3-dmrt2b Fig. 2 with image from Li et al., 2018
palatoquadrate cartilage EGFP expression decreased amount, abnormal y1Tg + MO3-dmrt2b Fig. S5 from Li et al., 2018
palatoquadrate cartilage decreased amount, abnormal y1Tg + MO3-dmrt2b Fig. 4 with image from Li et al., 2018
palatoquadrate cartilage ab1-col2a labeling decreased amount, abnormal y1Tg + MO3-dmrt2b Fig. 4 with image from Li et al., 2018
palatoquadrate cartilage morphology, abnormal TU + MO3-dmrt2b Fig. 2 with image from Li et al., 2018
parachordal cartilage decreased size, abnormal TU + MO3-dmrt2b Fig. 2 with image from Li et al., 2018
parachordal cartilage morphology, abnormal TU + MO3-dmrt2b Fig. 2 with image from Li et al., 2018
pharyngeal arch ab1-smad labeling decreased amount, abnormal y1Tg + MO3-dmrt2b Fig. 5 with image from Li et al., 2018
pharyngeal arch mCherry expression decreased amount, abnormal ioz22Tg; pt510Tg + MO3-dmrt2b Fig. 5 with image from Li et al., 2018
pharyngeal arch EGFP expression decreased amount, abnormal y1Tg + MO3-dmrt2b Fig. 3 with image,  Fig. 5 with image from Li et al., 2018
pharyngeal arch cranial neural crest EGFP expression decreased amount, abnormal y1Tg + MO3-dmrt2b Fig. S5 from Li et al., 2018
pharyngeal arch cranial neural crest cxcl12b expression decreased amount, abnormal TU + MO3-dmrt2b Fig. 3 with image from Li et al., 2018
pharyngeal arch neural crest EGFP expression decreased amount, abnormal ba2Tg; ioz15Tg + MO3-dmrt2b Fig. 3 with image from Li et al., 2018
pharyngeal arch neural crest hand2 expression decreased amount, abnormal TU + MO3-dmrt2b Fig. 3 with image from Li et al., 2018
pharyngeal arch neural crest decreased amount, abnormal ba2Tg; ioz15Tg + MO3-dmrt2b Fig. 3 with image from Li et al., 2018
pharyngeal arch 1 EGFP expression decreased amount, abnormal y1Tg + MO3-dmrt2b Fig. S6 from Li et al., 2018
pharyngeal arch 1 cell EGFP expression decreased amount, abnormal ba2Tg + MO3-dmrt2b Fig. 4 with image from Li et al., 2018
pharyngeal arch 1 cell Ab36-h3 labeling decreased amount, abnormal ba2Tg + MO3-dmrt2b Fig. 4 with image from Li et al., 2018
pharyngeal arch 1 neural crest decreased amount, abnormal ba2Tg; ioz15Tg + MO3-dmrt2b Fig. 3 with image from Li et al., 2018
pharyngeal arch 2 EGFP expression decreased amount, abnormal y1Tg + MO3-dmrt2b Fig. S6 from Li et al., 2018
pharyngeal arch 2 cell Ab36-h3 labeling decreased amount, abnormal ba2Tg + MO3-dmrt2b Fig. 4 with image from Li et al., 2018
pharyngeal arch 2 cell EGFP expression decreased amount, abnormal ba2Tg + MO3-dmrt2b Fig. 4 with image from Li et al., 2018
pharyngeal arch 2 neural crest decreased amount, abnormal ba2Tg; ioz15Tg + MO3-dmrt2b Fig. 3 with image from Li et al., 2018
pharyngeal arch 2 neural crest cell shape, abnormal ioz22Tg + MO3-dmrt2b Fig. 3 with image from Li et al., 2018
pharyngeal arch 3 neural crest decreased amount, abnormal ba2Tg; ioz15Tg + MO3-dmrt2b Fig. 3 with image from Li et al., 2018
pharyngeal arch 4 neural crest decreased amount, abnormal ba2Tg; ioz15Tg + MO3-dmrt2b Fig. 3 with image from Li et al., 2018
pharyngeal arch 5 neural crest decreased amount, abnormal ba2Tg; ioz15Tg + MO3-dmrt2b Fig. 3 with image from Li et al., 2018
pharyngeal arch 6 neural crest decreased amount, abnormal ba2Tg; ioz15Tg + MO3-dmrt2b Fig. 3 with image from Li et al., 2018
pharyngeal pouch bmper expression increased amount, abnormal TU + MO3-dmrt2b Fig. 5 with image from Li et al., 2018
trabecula cranii decreased size, abnormal TU + MO3-dmrt2b Fig. 2 with image from Li et al., 2018
whole organism dmrt2b expression decreased amount, abnormal TU + MO3-dmrt2b Fig. S2 from Li et al., 2018
Phenotype of all Fish created by or utilizing MO3-dmrt2b
Phenotype Fish Conditions Figures
head decreased size, abnormal TU + MO3-dmrt2b standard conditions Fig. S2 from Li et al., 2018
whole organism dmrt2b expression decreased amount, abnormal TU + MO3-dmrt2b standard conditions Fig. S2 from Li et al., 2018
ceratobranchial 4 cartilage morphology, abnormal TU + MO3-dmrt2b standard conditions Fig. 2 with image from Li et al., 2018
ceratobranchial 4 cartilage decreased size, abnormal TU + MO3-dmrt2b standard conditions Fig. 2 with image from Li et al., 2018
ethmoid cartilage morphology, abnormal TU + MO3-dmrt2b standard conditions Fig. 2 with image from Li et al., 2018
mandibular arch skeleton decreased size, abnormal TU + MO3-dmrt2b standard conditions Fig. S2 from Li et al., 2018
ceratobranchial 5 cartilage morphology, abnormal TU + MO3-dmrt2b standard conditions Fig. 2 with image from Li et al., 2018
Meckel's cartilage decreased size, abnormal TU + MO3-dmrt2b standard conditions Fig. 2 with image from Li et al., 2018
hyosymplectic cartilage decreased size, abnormal TU + MO3-dmrt2b standard conditions Fig. 2 with image from Li et al., 2018
ceratobranchial 3 cartilage decreased size, abnormal TU + MO3-dmrt2b standard conditions Fig. 2 with image from Li et al., 2018
trabecula cranii decreased size, abnormal TU + MO3-dmrt2b standard conditions Fig. 2 with image from Li et al., 2018
auditory capsule morphology, abnormal TU + MO3-dmrt2b standard conditions Fig. 2 with image from Li et al., 2018
Meckel's cartilage morphology, abnormal TU + MO3-dmrt2b standard conditions Fig. 2 with image from Li et al., 2018
ceratobranchial 3 cartilage morphology, abnormal TU + MO3-dmrt2b standard conditions Fig. 2 with image from Li et al., 2018
parachordal cartilage morphology, abnormal TU + MO3-dmrt2b standard conditions Fig. 2 with image from Li et al., 2018
hyosymplectic cartilage morphology, abnormal TU + MO3-dmrt2b standard conditions Fig. 2 with image from Li et al., 2018
ceratohyal cartilage decreased size, abnormal TU + MO3-dmrt2b standard conditions Fig. 2 with image from Li et al., 2018
ceratobranchial 2 cartilage decreased size, abnormal TU + MO3-dmrt2b standard conditions Fig. 2 with image from Li et al., 2018
palatoquadrate cartilage morphology, abnormal TU + MO3-dmrt2b standard conditions Fig. 2 with image from Li et al., 2018
mandibular arch skeleton morphology, abnormal TU + MO3-dmrt2b standard conditions Fig. S2 from Li et al., 2018
pharyngeal arch cranial neural crest cxcl12b expression decreased amount, abnormal TU + MO3-dmrt2b standard conditions Fig. 3 with image from Li et al., 2018
pharyngeal arch neural crest hand2 expression decreased amount, abnormal TU + MO3-dmrt2b standard conditions Fig. 3 with image from Li et al., 2018
pharyngeal pouch bmper expression increased amount, abnormal TU + MO3-dmrt2b standard conditions Fig. 5 with image from Li et al., 2018
ceratobranchial 1 cartilage decreased size, abnormal TU + MO3-dmrt2b standard conditions Fig. 2 with image from Li et al., 2018
ceratobranchial 1 cartilage morphology, abnormal TU + MO3-dmrt2b standard conditions Fig. 2 with image from Li et al., 2018
ceratobranchial 5 cartilage decreased size, abnormal TU + MO3-dmrt2b standard conditions Fig. 2 with image from Li et al., 2018
parachordal cartilage decreased size, abnormal TU + MO3-dmrt2b standard conditions Fig. 2 with image from Li et al., 2018
pharyngeal arch 2 cell Ab36-h3 labeling decreased amount, abnormal ba2Tg + MO3-dmrt2b standard conditions Fig. 4 with image from Li et al., 2018
pharyngeal arch 1 cell EGFP expression decreased amount, abnormal ba2Tg + MO3-dmrt2b standard conditions Fig. 4 with image from Li et al., 2018
pharyngeal arch 2 cell EGFP expression decreased amount, abnormal ba2Tg + MO3-dmrt2b standard conditions Fig. 4 with image from Li et al., 2018
pharyngeal arch 1 cell Ab36-h3 labeling decreased amount, abnormal ba2Tg + MO3-dmrt2b standard conditions Fig. 4 with image from Li et al., 2018
pharyngeal arch EGFP expression decreased amount, abnormal ba2Tg + MO3-dmrt2b standard conditions Fig. 3 with image from Li et al., 2018
pharyngeal arch 2 neural crest cell shape, abnormal ioz22Tg + MO3-dmrt2b standard conditions Fig. 3 with image from Li et al., 2018
pharyngeal arch ab1-smad labeling decreased amount, abnormal y1Tg + MO3-dmrt2b standard conditions Fig. 5 with image from Li et al., 2018
pharyngeal arch 1 EGFP expression decreased amount, abnormal y1Tg + MO3-dmrt2b standard conditions Fig. S6 from Li et al., 2018
palatoquadrate cartilage EGFP expression decreased amount, abnormal y1Tg + MO3-dmrt2b standard conditions Fig. S5 from Li et al., 2018
pharyngeal arch cranial neural crest EGFP expression decreased amount, abnormal y1Tg + MO3-dmrt2b standard conditions Fig. S5 from Li et al., 2018
palatoquadrate cartilage ab1-col2a labeling decreased amount, abnormal y1Tg + MO3-dmrt2b standard conditions Fig. 4 with image from Li et al., 2018
palatoquadrate cartilage decreased amount, abnormal y1Tg + MO3-dmrt2b standard conditions Fig. 4 with image from Li et al., 2018
ceratohyal cartilage ab1-col2a labeling decreased amount, abnormal y1Tg + MO3-dmrt2b standard conditions Fig. 4 with image from Li et al., 2018
pharyngeal arch EGFP expression decreased amount, abnormal y1Tg + MO3-dmrt2b standard conditions Fig. 3 with image,  Fig. 5 with image from Li et al., 2018
ceratohyal cartilage cranial neural crest EGFP expression decreased amount, abnormal y1Tg + MO3-dmrt2b standard conditions Fig. S5 from Li et al., 2018
pharyngeal arch 2 EGFP expression decreased amount, abnormal y1Tg + MO3-dmrt2b standard conditions Fig. S6 from Li et al., 2018
ceratohyal cartilage decreased amount, abnormal y1Tg + MO3-dmrt2b standard conditions Fig. 4 with image from Li et al., 2018
pharyngeal arch neural crest decreased amount, abnormal ba2Tg; ioz15Tg + MO3-dmrt2b standard conditions Fig. 3 with image from Li et al., 2018
pharyngeal arch neural crest EGFP expression decreased amount, abnormal ba2Tg; ioz15Tg + MO3-dmrt2b standard conditions Fig. 3 with image from Li et al., 2018
pharyngeal arch 6 neural crest decreased amount, abnormal ba2Tg; ioz15Tg + MO3-dmrt2b standard conditions Fig. 3 with image from Li et al., 2018
pharyngeal arch 4 neural crest decreased amount, abnormal ba2Tg; ioz15Tg + MO3-dmrt2b standard conditions Fig. 3 with image from Li et al., 2018
pharyngeal arch 3 neural crest decreased amount, abnormal ba2Tg; ioz15Tg + MO3-dmrt2b standard conditions Fig. 3 with image from Li et al., 2018
pharyngeal arch 1 neural crest decreased amount, abnormal ba2Tg; ioz15Tg + MO3-dmrt2b standard conditions Fig. 3 with image from Li et al., 2018
pharyngeal arch 2 neural crest decreased amount, abnormal ba2Tg; ioz15Tg + MO3-dmrt2b standard conditions Fig. 3 with image from Li et al., 2018
pharyngeal arch 5 neural crest decreased amount, abnormal ba2Tg; ioz15Tg + MO3-dmrt2b standard conditions Fig. 3 with image from Li et al., 2018
pharyngeal arch EGFP expression decreased amount, abnormal ioz22Tg; pt510Tg + MO3-dmrt2b standard conditions Fig. 5 with image from Li et al., 2018
pharyngeal arch mCherry expression decreased amount, abnormal ioz22Tg; pt510Tg + MO3-dmrt2b standard conditions Fig. 5 with image from Li et al., 2018
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.