Morpholino

MO1-myo1hb

ID
ZDB-MRPHLNO-190328-5
Name
MO1-myo1hb
Previous Names
None
Target
Sequence
5' - TCAGAGAGCCCTCCATCTCCTGCA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-myo1hb
Expressed Gene Anatomy Figures
sox9a Fig. 4 from Sun et al., 2018
Phenotype
Phenotype resulting from MO1-myo1hb
Phenotype Fish Figures
eye decreased size, abnormal TU + MO1-myo1hb Fig. 4 from Sun et al., 2018
head decreased size, abnormal TU + MO1-myo1hb Fig. 4 from Sun et al., 2018
mandibular arch skeleton sox9a expression decreased amount, abnormal TU + MO1-myo1hb Fig. 4 from Sun et al., 2018
mandibular arch skeleton decreased size, abnormal TU + MO1-myo1hb Fig. 3,  Fig. 4 from Sun et al., 2018
mandibular arch skeleton malformed, abnormal TU + MO1-myo1hb Fig. 3,  Fig. 4 from Sun et al., 2018
Meckel's cartilage deformed, abnormal TU + MO1-myo1hb Fig. 3,  Fig. 4 from Sun et al., 2018
mouth open, abnormal TU + MO1-myo1hb Fig. 3 from Sun et al., 2018
pericardium edematous, abnormal TU + MO1-myo1hb Fig. 4 from Sun et al., 2018
pharyngeal arch sox9a expression decreased amount, abnormal TU + MO1-myo1hb Fig. 4 from Sun et al., 2018
ventral mandibular arch decreased length, abnormal TU + MO1-myo1hb Fig. 3,  Fig. 4 from Sun et al., 2018
whole organism curved ventral, abnormal TU + MO1-myo1hb Fig. 4 from Sun et al., 2018
Phenotype of all Fish created by or utilizing MO1-myo1hb
Phenotype Fish Conditions Figures
eye decreased size, abnormal TU + MO1-myo1hb standard conditions Fig. 4 from Sun et al., 2018
ventral mandibular arch decreased length, abnormal TU + MO1-myo1hb standard conditions Fig. 3,  Fig. 4 from Sun et al., 2018
whole organism curved ventral, abnormal TU + MO1-myo1hb standard conditions Fig. 4 from Sun et al., 2018
mandibular arch skeleton malformed, abnormal TU + MO1-myo1hb standard conditions Fig. 3,  Fig. 4 from Sun et al., 2018
mandibular arch skeleton sox9a expression decreased amount, abnormal TU + MO1-myo1hb standard conditions Fig. 4 from Sun et al., 2018
pericardium edematous, abnormal TU + MO1-myo1hb standard conditions Fig. 4 from Sun et al., 2018
mouth open, abnormal TU + MO1-myo1hb standard conditions Fig. 3 from Sun et al., 2018
mandibular arch skeleton decreased size, abnormal TU + MO1-myo1hb standard conditions Fig. 3,  Fig. 4 from Sun et al., 2018
pharyngeal arch sox9a expression decreased amount, abnormal TU + MO1-myo1hb standard conditions Fig. 4 from Sun et al., 2018
head decreased size, abnormal TU + MO1-myo1hb standard conditions Fig. 4 from Sun et al., 2018
Meckel's cartilage deformed, abnormal TU + MO1-myo1hb standard conditions Fig. 3,  Fig. 4 from Sun et al., 2018
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.