Morpholino

MO1-cntrob

ID

ZDB-MRPHLNO-190221-2

Name

MO1-cntrob

Previous Names

None

Target

cntrob (1)

Sequence

5' - GTCTGTGAGATGTCTGTGAGCCGAG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

directed to ATG

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-cntrob

Expressed Gene	Anatomy	Figures
cntrob	whole organism	Fig. 4 from Ogungbenro et al., 2018
ins	pancreas	Fig. 5 from Ogungbenro et al., 2018
myl7	cardiac ventricle	Fig. 5 from Ogungbenro et al., 2018
spaw	lateral plate mesoderm right side	Fig. 5 from Ogungbenro et al., 2018

Phenotype

Phenotype resulting from MO1-cntrob

Phenotype	Fish	Figures
cardiac ventricle mislocalised, abnormal	WT + MO1-cntrob	Fig. 5 from Ogungbenro et al., 2018
determination of heart left/right asymmetry disrupted, abnormal	WT + MO1-cntrob	Fig. 5 from Ogungbenro et al., 2018
establishment of left/right asymmetry disrupted, abnormal	WT + MO1-cntrob	Fig. 5 from Ogungbenro et al., 2018
eye decreased size, abnormal	WT + MO1-cntrob	Fig. 4 from Ogungbenro et al., 2018
head decreased size, abnormal	WT + MO1-cntrob	Fig. 4 from Ogungbenro et al., 2018
heart edematous, abnormal	WT + MO1-cntrob	Fig. 4 from Ogungbenro et al., 2018
Kupffer's vesicle cilium decreased amount, abnormal	WT + MO1-cntrob	Fig. 4 from Ogungbenro et al., 2018
Kupffer's vesicle cilium decreased length, abnormal	WT + MO1-cntrob	Fig. 4 from Ogungbenro et al., 2018
lateral plate mesoderm spaw expression mislocalised, abnormal	WT + MO1-cntrob	Fig. 5 from Ogungbenro et al., 2018
lateral plate mesoderm right side spaw expression mislocalised, abnormal	WT + MO1-cntrob	Fig. 5 from Ogungbenro et al., 2018
otolith physical object quality, abnormal	WT + MO1-cntrob	Fig. 4 from Ogungbenro et al., 2018
pancreas mislocalised, abnormal	WT + MO1-cntrob	Fig. 5 from Ogungbenro et al., 2018
whole organism cntrob expression decreased amount, abnormal	WT + MO1-cntrob	Fig. 4 from Ogungbenro et al., 2018
whole organism axis curved, abnormal	WT + MO1-cntrob	Fig. 4 from Ogungbenro et al., 2018
whole organism axis decreased length, abnormal	WT + MO1-cntrob	Fig. 4 from Ogungbenro et al., 2018

Phenotype of all Fish created by or utilizing MO1-cntrob

Phenotype	Fish	Conditions	Figures
whole organism axis curved, abnormal	WT + MO1-cntrob	standard conditions	Fig. 4 from Ogungbenro et al., 2018
cardiac ventricle mislocalised, abnormal	WT + MO1-cntrob	standard conditions	Fig. 5 from Ogungbenro et al., 2018
whole organism cntrob expression decreased amount, abnormal	WT + MO1-cntrob	standard conditions	Fig. 4 from Ogungbenro et al., 2018
determination of heart left/right asymmetry disrupted, abnormal	WT + MO1-cntrob	standard conditions	Fig. 5 from Ogungbenro et al., 2018
Kupffer's vesicle cilium decreased amount, abnormal	WT + MO1-cntrob	standard conditions	Fig. 4 from Ogungbenro et al., 2018
eye decreased size, abnormal	WT + MO1-cntrob	standard conditions	Fig. 4 from Ogungbenro et al., 2018
whole organism axis decreased length, abnormal	WT + MO1-cntrob	standard conditions	Fig. 4 from Ogungbenro et al., 2018
Kupffer's vesicle cilium decreased length, abnormal	WT + MO1-cntrob	standard conditions	Fig. 4 from Ogungbenro et al., 2018
head decreased size, abnormal	WT + MO1-cntrob	standard conditions	Fig. 4 from Ogungbenro et al., 2018
lateral plate mesoderm right side spaw expression mislocalised, abnormal	WT + MO1-cntrob	standard conditions	Fig. 5 from Ogungbenro et al., 2018
pancreas mislocalised, abnormal	WT + MO1-cntrob	standard conditions	Fig. 5 from Ogungbenro et al., 2018
heart edematous, abnormal	WT + MO1-cntrob	standard conditions	Fig. 4 from Ogungbenro et al., 2018
establishment of left/right asymmetry disrupted, abnormal	WT + MO1-cntrob	standard conditions	Fig. 5 from Ogungbenro et al., 2018
otolith physical object quality, abnormal	WT + MO1-cntrob	standard conditions	Fig. 4 from Ogungbenro et al., 2018
lateral plate mesoderm spaw expression mislocalised, abnormal	WT + MO1-cntrob	standard conditions	Fig. 5 from Ogungbenro et al., 2018

Citations