Morpholino

MO1-mid1ip1b

ID
ZDB-MRPHLNO-181218-6
Name
MO1-mid1ip1b
Previous Names
None
Target
Sequence
5' - GATTTGCATCATCTTTGCTGTCCTA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mid1ip1b
Expressed Gene Anatomy Figures
ins Fig. 1 from Zhou et al., 2018
pdx1 Fig. 1 from Zhou et al., 2018
prss1 Fig. 1 from Zhou et al., 2018
Phenotype
Phenotype resulting from MO1-mid1ip1b
Phenotype Fish Figures
exocrine pancreas decreased size, abnormal WT + MO1-mid1ip1b Fig. 1 from Zhou et al., 2018
exocrine pancreas position, abnormal WT + MO1-mid1ip1b Fig. 1 from Zhou et al., 2018
exocrine pancreas prss1 expression spatial pattern, abnormal WT + MO1-mid1ip1b Fig. 1 from Zhou et al., 2018
fourth ventricle decreased size, abnormal WT + MO1-mid1ip1b Fig. 1 from Zhou et al., 2018
fourth ventricle apical side lacks parts or has fewer parts of type fourth ventricle cilium, abnormal WT + MO1-mid1ip1b Fig. 5 from Zhou et al., 2018
fourth ventricle cilium decreased amount, abnormal WT + MO1-mid1ip1b Fig. 5 from Zhou et al., 2018
fourth ventricle cilium mislocalised, abnormal WT + MO1-mid1ip1b Fig. 5 from Zhou et al., 2018
fourth ventricle epithelial tube formation decreased occurrence, abnormal WT + MO1-mid1ip1b Fig. 1 from Zhou et al., 2018
gut increased width, abnormal WT + MO1-mid1ip1b Fig. 1 from Zhou et al., 2018
gut shortened, abnormal WT + MO1-mid1ip1b Fig. 1 from Zhou et al., 2018
gut pdx1 expression spatial pattern, abnormal WT + MO1-mid1ip1b Fig. 1 from Zhou et al., 2018
gut apical side ab1-tubg1 labeling absent, abnormal WT + MO1-mid1ip1b Fig. 3 from Zhou et al., 2018
gut apical side has fewer parts of type gut microtubule, abnormal WT + MO1-mid1ip1b Fig. 6 from Zhou et al., 2018
gut apical side lacks parts or has fewer parts of type gut gamma-tubulin complex, abnormal WT + MO1-mid1ip1b Fig. 3 from Zhou et al., 2018
gut epithelial tube formation decreased occurrence, abnormal WT + MO1-mid1ip1b Fig. 2 from Zhou et al., 2018
gut gamma-tubulin complex absent, abnormal WT + MO1-mid1ip1b Fig. 3 from Zhou et al., 2018
pancreas pdx1 expression decreased amount, abnormal WT + MO1-mid1ip1b Fig. 1 from Zhou et al., 2018
pancreatic duct epithelial tube formation decreased occurrence, abnormal WT + MO1-mid1ip1b Fig. 2 from Zhou et al., 2018
pronephric duct nephric duct formation decreased occurrence, abnormal WT + MO1-mid1ip1b Fig. 2 from Zhou et al., 2018
tectal ventricle decreased size, abnormal WT + MO1-mid1ip1b Fig. 1 from Zhou et al., 2018
tectal ventricle epithelial tube formation decreased occurrence, abnormal WT + MO1-mid1ip1b Fig. 1 from Zhou et al., 2018
ventricular system apical side ab1-tubg1 labeling absent, abnormal WT + MO1-mid1ip1b Fig. 3,  Fig. 5 from Zhou et al., 2018
ventricular system apical side has fewer parts of type ventricular system microtubule organizing center, abnormal WT + MO1-mid1ip1b Fig. 5 from Zhou et al., 2018
ventricular system apical side has fewer parts of type ventricular system microtubule, abnormal WT + MO1-mid1ip1b Fig. 6 from Zhou et al., 2018
ventricular system apical side lacks parts or has fewer parts of type ventricular system gamma-tubulin complex, abnormal WT + MO1-mid1ip1b Fig. 3,  Fig. 5 from Zhou et al., 2018
ventricular system gamma-tubulin complex absent, abnormal WT + MO1-mid1ip1b Fig. 3 from Zhou et al., 2018
whole organism shortened, abnormal WT + MO1-mid1ip1b Fig. 1 from Zhou et al., 2018
Phenotype of all Fish created by or utilizing MO1-mid1ip1b
Phenotype Fish Conditions Figures
fourth ventricle cilium decreased amount, abnormal WT + MO1-mid1ip1b standard conditions Fig. 5 from Zhou et al., 2018
pancreas pdx1 expression decreased amount, abnormal WT + MO1-mid1ip1b standard conditions Fig. 1 from Zhou et al., 2018
ventricular system apical side lacks parts or has fewer parts of type ventricular system gamma-tubulin complex, abnormal WT + MO1-mid1ip1b standard conditions Fig. 3,  Fig. 5 from Zhou et al., 2018
exocrine pancreas decreased size, abnormal WT + MO1-mid1ip1b standard conditions Fig. 1 from Zhou et al., 2018
ventricular system apical side has fewer parts of type ventricular system microtubule organizing center, abnormal WT + MO1-mid1ip1b standard conditions Fig. 5 from Zhou et al., 2018
tectal ventricle decreased size, abnormal WT + MO1-mid1ip1b standard conditions Fig. 1 from Zhou et al., 2018
exocrine pancreas prss1 expression spatial pattern, abnormal WT + MO1-mid1ip1b standard conditions Fig. 1 from Zhou et al., 2018
pronephric duct nephric duct formation decreased occurrence, abnormal WT + MO1-mid1ip1b standard conditions Fig. 2 from Zhou et al., 2018
gut increased width, abnormal WT + MO1-mid1ip1b standard conditions Fig. 1 from Zhou et al., 2018
gut pdx1 expression spatial pattern, abnormal WT + MO1-mid1ip1b standard conditions Fig. 1 from Zhou et al., 2018
tectal ventricle epithelial tube formation decreased occurrence, abnormal WT + MO1-mid1ip1b standard conditions Fig. 1 from Zhou et al., 2018
fourth ventricle decreased size, abnormal WT + MO1-mid1ip1b standard conditions Fig. 1 from Zhou et al., 2018
ventricular system apical side has fewer parts of type ventricular system microtubule, abnormal WT + MO1-mid1ip1b standard conditions Fig. 6 from Zhou et al., 2018
pancreatic duct epithelial tube formation decreased occurrence, abnormal WT + MO1-mid1ip1b standard conditions Fig. 2 from Zhou et al., 2018
fourth ventricle cilium mislocalised, abnormal WT + MO1-mid1ip1b standard conditions Fig. 5 from Zhou et al., 2018
fourth ventricle apical side lacks parts or has fewer parts of type fourth ventricle cilium, abnormal WT + MO1-mid1ip1b standard conditions Fig. 5 from Zhou et al., 2018
gut apical side ab1-tubg1 labeling absent, abnormal WT + MO1-mid1ip1b standard conditions Fig. 3 from Zhou et al., 2018
ventricular system apical side ab1-tubg1 labeling absent, abnormal WT + MO1-mid1ip1b standard conditions Fig. 3,  Fig. 5 from Zhou et al., 2018
gut apical side has fewer parts of type gut microtubule, abnormal WT + MO1-mid1ip1b standard conditions Fig. 6 from Zhou et al., 2018
whole organism shortened, abnormal WT + MO1-mid1ip1b standard conditions Fig. 1 from Zhou et al., 2018
fourth ventricle epithelial tube formation decreased occurrence, abnormal WT + MO1-mid1ip1b standard conditions Fig. 1 from Zhou et al., 2018
gut gamma-tubulin complex absent, abnormal WT + MO1-mid1ip1b standard conditions Fig. 3 from Zhou et al., 2018
gut epithelial tube formation decreased occurrence, abnormal WT + MO1-mid1ip1b standard conditions Fig. 2 from Zhou et al., 2018
gut shortened, abnormal WT + MO1-mid1ip1b standard conditions Fig. 1 from Zhou et al., 2018
ventricular system gamma-tubulin complex absent, abnormal WT + MO1-mid1ip1b standard conditions Fig. 3 from Zhou et al., 2018
gut apical side lacks parts or has fewer parts of type gut gamma-tubulin complex, abnormal WT + MO1-mid1ip1b standard conditions Fig. 3 from Zhou et al., 2018
exocrine pancreas position, abnormal WT + MO1-mid1ip1b standard conditions Fig. 1 from Zhou et al., 2018
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.