Morpholino

MO3-ifnlr1

ID
ZDB-MRPHLNO-180913-1
Name
MO3-ifnlr1
Previous Names
  • ifnlr1-e4i4-MO (1)
Target
Sequence
5' - AGAGATGATACTAACCTGTGATCCG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-ifnlr1
No data available
Phenotype
Phenotype resulting from MO3-ifnlr1
Phenotype of all Fish created by or utilizing MO3-ifnlr1
Phenotype Fish Conditions Figures
whole organism crfb4 expression increased amount, abnormal AB + MO3-ifnlr1 standard conditions Fig. 5 from Gao et al., 2018
neuromast hair cell decreased amount, abnormal AB + MO3-ifnlr1 standard conditions Fig. 3 with imageFig. 4 with image from Gao et al., 2018
intestine lumen distended, abnormal AB + MO3-ifnlr1 standard conditions Fig. 3 with image from Gao et al., 2018
neuromast decreased amount, abnormal AB + MO3-ifnlr1 standard conditions Fig. 1 with image from Wang et al., 2021
Fig. 3 with imageFig. 4 with image from Gao et al., 2018
whole organism stat3 expression increased amount, abnormal AB + MO3-ifnlr1 standard conditions Fig. 5 from Gao et al., 2018
whole organism tyk2 expression increased amount, abnormal AB + MO3-ifnlr1 standard conditions Fig. 5 from Gao et al., 2018
swim bladder uninflated, abnormal AB + MO3-ifnlr1 standard conditions Fig. 1 with image from Wang et al., 2021
Fig. 3 with imageFig. 4 with image from Gao et al., 2018
whole organism stat5b expression increased amount, abnormal AB + MO3-ifnlr1 standard conditions Fig. 5 from Gao et al., 2018
whole organism jak1 expression increased amount, abnormal AB + MO3-ifnlr1 standard conditions Fig. 5 from Gao et al., 2018
whole organism stat5a expression decreased amount, abnormal AB + MO3-ifnlr1 standard conditions Fig. 6 with image from Wang et al., 2021
cell surface receptor signaling pathway via JAK-STAT increased occurrence, abnormal AB + MO3-ifnlr1 standard conditions Fig. 5 from Gao et al., 2018
neuromast cell population proliferation decreased occurrence, abnormal s356tTg + MO3-ifnlr1 standard conditions Fig. 3 with image from Gao et al., 2018
neuromast support cell decreased amount, abnormal s356tTg + MO3-ifnlr1 standard conditions Fig. 3 with image from Gao et al., 2018
neuromast decreased amount, abnormal s356tTg + MO3-ifnlr1 standard conditions Fig. 3 with image from Gao et al., 2018
neuromast hair cell decreased amount, abnormal s356tTg + MO3-ifnlr1 standard conditions Fig. 3 with image from Gao et al., 2018
Citations