Morpholino

MO1-tekt1

ID
ZDB-MRPHLNO-180530-1
Name
MO1-tekt1
Previous Names
None
Target
Sequence
5' - GGTTGGTTTGTTTTACATACCCAGT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tekt1
No data available
Phenotype
Phenotype resulting from MO1-tekt1
Phenotype Fish Figures
determination of heart left/right asymmetry decreased process quality, abnormal WT + MO1-tekt1 Fig. 7 from Ryan et al., 2017
heart bilateral symmetry, abnormal WT + MO1-tekt1 Fig. 7 from Ryan et al., 2017
heart heart morphogenesis decreased process quality, abnormal WT + MO1-tekt1 Fig. 9 from Ryan et al., 2017
Kupffer's vesicle has fewer parts of type Kupffer's vesicle motile cilium, abnormal hsc5Tg + MO1-tekt1 Fig. 8 from Ryan et al., 2017
Kupffer's vesicle epithelial cilium movement involved in extracellular fluid movement decreased process quality, abnormal hsc5Tg + MO1-tekt1 Fig. 8 from Ryan et al., 2017
Kupffer's vesicle motile cilium assembly decreased occurrence, abnormal hsc5Tg + MO1-tekt1 Fig. 8 from Ryan et al., 2017
lateral plate mesoderm determination of left/right asymmetry in lateral mesoderm decreased process quality, abnormal WT + MO1-tekt1 Fig. 7 from Ryan et al., 2017
lateral plate mesoderm right side spaw expression mislocalised, abnormal WT + MO1-tekt1 Fig. 7 from Ryan et al., 2017
otic vesicle has extra parts of type otolith, abnormal WT + MO1-tekt1 Fig. 7 from Ryan et al., 2017
otic vesicle otolith development decreased process quality, abnormal WT + MO1-tekt1 Fig. 9 from Ryan et al., 2017
otolith malformed, abnormal WT + MO1-tekt1 Fig. 7 from Ryan et al., 2017
otolith development decreased process quality, abnormal WT + MO1-tekt1 Fig. 7 from Ryan et al., 2017
post-vent region curved ventral, abnormal WT + MO1-tekt1 Fig. 9 from Ryan et al., 2017
pronephros cystic, abnormal li1Tg + MO1-tekt1 Fig. 7Fig. 9 from Ryan et al., 2017
pronephros epithelial cilium movement involved in extracellular fluid movement decreased process quality, abnormal hsc5Tg + MO1-tekt1 Fig. 8 from Ryan et al., 2017
pronephros development decreased process quality, abnormal WT + MO1-tekt1 Fig. 7Fig. 9 from Ryan et al., 2017
Phenotype of all Fish created by or utilizing MO1-tekt1
Phenotype Fish Conditions Figures
heart bilateral symmetry, abnormal WT + MO1-tekt1 standard conditions Fig. 7 from Ryan et al., 2017
pronephros development decreased process quality, abnormal WT + MO1-tekt1 standard conditions Fig. 9 from Ryan et al., 2017
otic vesicle otolith development decreased process quality, abnormal WT + MO1-tekt1 standard conditions Fig. 9 from Ryan et al., 2017
otic vesicle has extra parts of type otolith, abnormal WT + MO1-tekt1 standard conditions Fig. 7 from Ryan et al., 2017
lateral plate mesoderm right side spaw expression mislocalised, abnormal WT + MO1-tekt1 standard conditions Fig. 7 from Ryan et al., 2017
otolith development decreased process quality, abnormal WT + MO1-tekt1 standard conditions Fig. 7 from Ryan et al., 2017
determination of heart left/right asymmetry decreased process quality, abnormal WT + MO1-tekt1 standard conditions Fig. 7 from Ryan et al., 2017
lateral plate mesoderm determination of left/right asymmetry in lateral mesoderm decreased process quality, abnormal WT + MO1-tekt1 standard conditions Fig. 7 from Ryan et al., 2017
post-vent region curved ventral, abnormal WT + MO1-tekt1 standard conditions Fig. 9 from Ryan et al., 2017
otolith malformed, abnormal WT + MO1-tekt1 standard conditions Fig. 7 from Ryan et al., 2017
pronephros cystic, abnormal WT + MO1-tekt1 standard conditions Fig. 9 from Ryan et al., 2017
heart heart morphogenesis decreased process quality, abnormal WT + MO1-tekt1 standard conditions Fig. 9 from Ryan et al., 2017
pronephros epithelial cilium movement involved in extracellular fluid movement decreased process quality, abnormal hsc5Tg + MO1-tekt1 standard conditions Fig. 8 from Ryan et al., 2017
Kupffer's vesicle has fewer parts of type Kupffer's vesicle motile cilium, abnormal hsc5Tg + MO1-tekt1 standard conditions Fig. 8 from Ryan et al., 2017
Kupffer's vesicle epithelial cilium movement involved in extracellular fluid movement decreased process quality, abnormal hsc5Tg + MO1-tekt1 standard conditions Fig. 8 from Ryan et al., 2017
Kupffer's vesicle motile cilium assembly decreased occurrence, abnormal hsc5Tg + MO1-tekt1 standard conditions Fig. 8 from Ryan et al., 2017
pronephros cystic, abnormal li1Tg + MO1-tekt1 standard conditions Fig. 7 from Ryan et al., 2017
pronephros development decreased process quality, abnormal li1Tg + MO1-tekt1 standard conditions Fig. 7 from Ryan et al., 2017
pronephros development decreased process quality, abnormal WT + MO1-tekt1 + MO1-wdr19 standard conditions Fig. 9 from Ryan et al., 2017
otic vesicle otolith development decreased process quality, abnormal WT + MO1-tekt1 + MO1-wdr19 standard conditions Fig. 9 from Ryan et al., 2017
post-vent region curved ventral, abnormal WT + MO1-tekt1 + MO1-wdr19 standard conditions Fig. 9 from Ryan et al., 2017
brain hydrocephalic, abnormal WT + MO1-tekt1 + MO1-wdr19 standard conditions Fig. 9 from Ryan et al., 2017
head decreased size, abnormal WT + MO1-tekt1 + MO1-wdr19 standard conditions Fig. 9 from Ryan et al., 2017
pronephros cystic, abnormal WT + MO1-tekt1 + MO1-wdr19 standard conditions Fig. 9 from Ryan et al., 2017
heart heart morphogenesis decreased process quality, abnormal WT + MO1-tekt1 + MO1-wdr19 standard conditions Fig. 9 from Ryan et al., 2017
Citations