Morpholino

MO2-atp5md

ID
ZDB-MRPHLNO-180510-4
Name
MO2-atp5md
Previous Names
  • MO2-si:dkey-80c12.10
Target
Sequence
5' - TAATGTCGACTTACATTCCTCCTGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-atp5md
No data available
Phenotype
Phenotype resulting from MO2-atp5md
No data available
Phenotype of all Fish created by or utilizing MO2-atp5md
Phenotype Fish Conditions Figures
whole organism mybpc3 expression decreased amount, abnormal nkhspGFF3AEt + MO1-atp5md + MO2-atp5md standard conditions Fig. 6 from Nagata et al., 2017
whole organism atp2b3a expression decreased amount, abnormal nkhspGFF3AEt + MO1-atp5md + MO2-atp5md standard conditions Fig. 6 from Nagata et al., 2017
pericardium swollen, abnormal nkhspGFF3AEt + MO1-atp5md + MO2-atp5md standard conditions Fig. 2 with imageFig. S2 from Nagata et al., 2017
cardiac ventricle decreased functionality, abnormal nkhspGFF3AEt + MO1-atp5md + MO2-atp5md standard conditions Fig. 3 from Nagata et al., 2017
whole organism slc8a1b expression decreased amount, abnormal nkhspGFF3AEt + MO1-atp5md + MO2-atp5md standard conditions Fig. 6 from Nagata et al., 2017
pericardium increased area, abnormal nkhspGFF3AEt + MO1-atp5md + MO2-atp5md standard conditions Fig. 3 from Nagata et al., 2017
atrium increased area, abnormal nkhspGFF3AEt + MO1-atp5md + MO2-atp5md standard conditions Fig. 3 from Nagata et al., 2017
whole organism tnnt2c expression decreased amount, abnormal nkhspGFF3AEt + MO1-atp5md + MO2-atp5md standard conditions Fig. 6 from Nagata et al., 2017
whole organism myh7 expression decreased amount, abnormal nkhspGFF3AEt + MO1-atp5md + MO2-atp5md standard conditions Fig. 6 from Nagata et al., 2017
whole organism nppb expression increased amount, abnormal nkhspGFF3AEt + MO1-atp5md + MO2-atp5md standard conditions Fig. 6 from Nagata et al., 2017
whole organism atp2a2a expression decreased amount, abnormal nkhspGFF3AEt + MO1-atp5md + MO2-atp5md standard conditions Fig. 6 from Nagata et al., 2017
whole organism myl7 expression decreased amount, abnormal nkhspGFF3AEt + MO1-atp5md + MO2-atp5md standard conditions Fig. 6 from Nagata et al., 2017
whole organism ryr3 expression decreased amount, abnormal nkhspGFF3AEt + MO1-atp5md + MO2-atp5md standard conditions Fig. 6 from Nagata et al., 2017
whole organism nppa expression increased amount, abnormal nkhspGFF3AEt + MO1-atp5md + MO2-atp5md standard conditions Fig. 6 from Nagata et al., 2017
cardiac ventricle heart contraction decreased process quality, abnormal nkhspGFF3AEt + MO1-atp5md + MO2-atp5md standard conditions Fig. 2 with image from Nagata et al., 2017
Citations