Morpholino

MO1-gabra2a

ID
ZDB-MRPHLNO-180418-1
Name
MO1-gabra2a
Previous Names
None
Target
Sequence
5' - GAGAATGACCCCGTCGCAGAATCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-gabra2a
Expressed Gene Anatomy Figures
fgf8a Fig. 6 with image from Gonzalez-Nunez, 2015
gad1b Fig. 7 with image from Gonzalez-Nunez, 2015
neurod1 Fig. 6 with image from Gonzalez-Nunez, 2015
notch1a Fig. 6 with image from Gonzalez-Nunez, 2015
pax2a Fig. 6 with image from Gonzalez-Nunez, 2015
wnt1 Fig. 6 with image from Gonzalez-Nunez, 2015
Phenotype
Phenotype resulting from MO1-gabra2a
Phenotype Fish Figures
brain notch1a expression increased amount, abnormal AB + MO1-gabra2a Fig. 6 with image from Gonzalez-Nunez, 2015
cerebellum neurod1 expression absent, abnormal AB + MO1-gabra2a Fig. 6 with image from Gonzalez-Nunez, 2015
cerebellum pax2a expression decreased amount, abnormal AB + MO1-gabra2a Fig. 6 with image from Gonzalez-Nunez, 2015
cerebellum pax2a expression increased amount, abnormal AB + MO1-gabra2a Fig. 6 with image from Gonzalez-Nunez, 2015
forebrain pax2a expression increased amount, abnormal AB + MO1-gabra2a Fig. 6 with image from Gonzalez-Nunez, 2015
forebrain cell apoptotic, abnormal AB + MO1-gabra2a Fig. 5 with image from Gonzalez-Nunez, 2015
hindbrain gad1b expression decreased amount, abnormal AB + MO1-gabra2a Fig. 7 with image from Gonzalez-Nunez, 2015
hindbrain pax2a expression increased amount, abnormal AB + MO1-gabra2a Fig. 6 with image from Gonzalez-Nunez, 2015
hindbrain apoptotic process increased occurrence, abnormal AB + MO1-gabra2a Fig. 5 with image from Gonzalez-Nunez, 2015
hindbrain cell apoptotic, abnormal AB + MO1-gabra2a Fig. 5 with image from Gonzalez-Nunez, 2015
hindbrain dorsal region wnt1 expression decreased amount, abnormal AB + MO1-gabra2a Fig. 6 with image from Gonzalez-Nunez, 2015
hindbrain dorso-lateral region wnt1 expression increased amount, abnormal AB + MO1-gabra2a Fig. 6 with image from Gonzalez-Nunez, 2015
hindbrain nucleus gad1b expression decreased amount, abnormal AB + MO1-gabra2a Fig. 7 with image from Gonzalez-Nunez, 2015
medulla oblongata pax2a expression decreased amount, abnormal AB + MO1-gabra2a Fig. 6 with image from Gonzalez-Nunez, 2015
midbrain gad1b expression decreased amount, abnormal AB + MO1-gabra2a Fig. 7 with image from Gonzalez-Nunez, 2015
midbrain dorsal region wnt1 expression decreased amount, abnormal AB + MO1-gabra2a Fig. 6 with image from Gonzalez-Nunez, 2015
midbrain hindbrain boundary wnt1 expression decreased amount, abnormal AB + MO1-gabra2a Fig. 6 with image from Gonzalez-Nunez, 2015
midbrain hindbrain boundary fgf8a expression increased amount, abnormal AB + MO1-gabra2a Fig. 6 with image from Gonzalez-Nunez, 2015
olfactory bulb gad1b expression decreased amount, abnormal AB + MO1-gabra2a Fig. 7 with image from Gonzalez-Nunez, 2015
spinal cord neurod1 expression decreased amount, abnormal AB + MO1-gabra2a Fig. 6 with image from Gonzalez-Nunez, 2015
spinal cord wnt1 expression decreased amount, abnormal AB + MO1-gabra2a Fig. 6 with image from Gonzalez-Nunez, 2015
spinal cord notch1a expression decreased amount, abnormal AB + MO1-gabra2a Fig. 6 with image from Gonzalez-Nunez, 2015
tegmentum Ab46-h3 labeling increased amount, abnormal AB + MO1-gabra2a Fig. 4 with image from Gonzalez-Nunez, 2015
third ventricle cell apoptotic, abnormal AB + MO1-gabra2a Fig. 5 with image from Gonzalez-Nunez, 2015
ventricular zone Ab46-h3 labeling spatial pattern, abnormal AB + MO1-gabra2a Fig. 4 with image from Gonzalez-Nunez, 2015
whole organism notch1a expression decreased amount, abnormal AB + MO1-gabra2a Fig. 6 with image from Gonzalez-Nunez, 2015
Phenotype of all Fish created by or utilizing MO1-gabra2a
Phenotype Fish Conditions Figures
hindbrain apoptotic process increased occurrence, abnormal AB + MO1-gabra2a standard conditions Fig. 5 with image from Gonzalez-Nunez, 2015
midbrain hindbrain boundary wnt1 expression decreased amount, abnormal AB + MO1-gabra2a standard conditions Fig. 6 with image from Gonzalez-Nunez, 2015
forebrain cell apoptotic, abnormal AB + MO1-gabra2a standard conditions Fig. 5 with image from Gonzalez-Nunez, 2015
medulla oblongata pax2a expression decreased amount, abnormal AB + MO1-gabra2a standard conditions Fig. 6 with image from Gonzalez-Nunez, 2015
olfactory bulb gad1b expression decreased amount, abnormal AB + MO1-gabra2a standard conditions Fig. 7 with image from Gonzalez-Nunez, 2015
forebrain pax2a expression increased amount, abnormal AB + MO1-gabra2a standard conditions Fig. 6 with image from Gonzalez-Nunez, 2015
hindbrain cell apoptotic, abnormal AB + MO1-gabra2a standard conditions Fig. 5 with image from Gonzalez-Nunez, 2015
ventricular zone Ab46-h3 labeling spatial pattern, abnormal AB + MO1-gabra2a standard conditions Fig. 4 with image from Gonzalez-Nunez, 2015
midbrain hindbrain boundary fgf8a expression increased amount, abnormal AB + MO1-gabra2a standard conditions Fig. 6 with image from Gonzalez-Nunez, 2015
cerebellum pax2a expression decreased amount, abnormal AB + MO1-gabra2a standard conditions Fig. 6 with image from Gonzalez-Nunez, 2015
hindbrain nucleus gad1b expression decreased amount, abnormal AB + MO1-gabra2a standard conditions Fig. 7 with image from Gonzalez-Nunez, 2015
midbrain gad1b expression decreased amount, abnormal AB + MO1-gabra2a standard conditions Fig. 7 with image from Gonzalez-Nunez, 2015
cerebellum pax2a expression increased amount, abnormal AB + MO1-gabra2a standard conditions Fig. 6 with image from Gonzalez-Nunez, 2015
hindbrain pax2a expression increased amount, abnormal AB + MO1-gabra2a standard conditions Fig. 6 with image from Gonzalez-Nunez, 2015
hindbrain dorsal region wnt1 expression decreased amount, abnormal AB + MO1-gabra2a standard conditions Fig. 6 with image from Gonzalez-Nunez, 2015
spinal cord neurod1 expression decreased amount, abnormal AB + MO1-gabra2a standard conditions Fig. 6 with image from Gonzalez-Nunez, 2015
hindbrain gad1b expression decreased amount, abnormal AB + MO1-gabra2a standard conditions Fig. 7 with image from Gonzalez-Nunez, 2015
whole organism notch1a expression decreased amount, abnormal AB + MO1-gabra2a standard conditions Fig. 6 with image from Gonzalez-Nunez, 2015
third ventricle cell apoptotic, abnormal AB + MO1-gabra2a standard conditions Fig. 5 with image from Gonzalez-Nunez, 2015
spinal cord notch1a expression decreased amount, abnormal AB + MO1-gabra2a standard conditions Fig. 6 with image from Gonzalez-Nunez, 2015
hindbrain dorso-lateral region wnt1 expression increased amount, abnormal AB + MO1-gabra2a standard conditions Fig. 6 with image from Gonzalez-Nunez, 2015
midbrain dorsal region wnt1 expression decreased amount, abnormal AB + MO1-gabra2a standard conditions Fig. 6 with image from Gonzalez-Nunez, 2015
spinal cord wnt1 expression decreased amount, abnormal AB + MO1-gabra2a standard conditions Fig. 6 with image from Gonzalez-Nunez, 2015
cerebellum neurod1 expression absent, abnormal AB + MO1-gabra2a standard conditions Fig. 6 with image from Gonzalez-Nunez, 2015
tegmentum Ab46-h3 labeling increased amount, abnormal AB + MO1-gabra2a standard conditions Fig. 4 with image from Gonzalez-Nunez, 2015
brain notch1a expression increased amount, abnormal AB + MO1-gabra2a standard conditions Fig. 6 with image from Gonzalez-Nunez, 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.