Morpholino

MO2-polr1c

ID
ZDB-MRPHLNO-180314-1
Name
MO2-polr1c
Previous Names
  • intron1 and exon2 (1)
Target
Sequence
5' - TGGACCTGTATAAATTAGATACAGT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This is a splice-blocking photo-morpholino.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-polr1c
Expressed Gene Anatomy Figures
dlx2a Fig. 2 from Kwong et al., 2017
tp53 Fig. 3 from Kwong et al., 2017
Phenotype
Phenotype resulting from MO2-polr1c
Phenotype Fish Figures
ethmoid cartilage decreased length, abnormal AB + MO2-polr1c Fig. 1 from Kwong et al., 2017
ethmoid cartilage decreased width, abnormal AB + MO2-polr1c Fig. 1 from Kwong et al., 2017
ethmoid cartilage anterior margin emarginate, abnormal AB + MO2-polr1c Fig. 1 from Kwong et al., 2017
head apoptotic, abnormal AB + MO2-polr1c Fig. 2 from Kwong et al., 2017
pharyngeal arch 3-7 dlx2a expression decreased amount, abnormal AB + MO2-polr1c Fig. 2 from Kwong et al., 2017
pharyngeal arch 3-7 has fewer parts of type ectomesenchyme, abnormal y1Tg + MO2-polr1c Fig. 2 from Kwong et al., 2017
whole organism tp53 expression increased amount, abnormal AB + MO2-polr1c Fig. 3 from Kwong et al., 2017
Phenotype of all Fish created by or utilizing MO2-polr1c
Phenotype Fish Conditions Figures
head apoptotic, abnormal AB + MO2-polr1c standard conditions Fig. 2 from Kwong et al., 2017
ethmoid cartilage anterior margin emarginate, ameliorated AB + MO2-polr1c ultraviolet light Fig. 1 from Kwong et al., 2017
head apoptotic, ameliorated AB + MO2-polr1c ultraviolet light Fig. 2 from Kwong et al., 2017
ethmoid cartilage decreased length, ameliorated AB + MO2-polr1c ultraviolet light Fig. 1 from Kwong et al., 2017
whole organism tp53 expression amount, ameliorated AB + MO2-polr1c ultraviolet light Fig. 3 from Kwong et al., 2017
ethmoid cartilage anterior margin emarginate, abnormal AB + MO2-polr1c standard conditions Fig. 1 from Kwong et al., 2017
pharyngeal arch 3-7 dlx2a expression decreased amount, abnormal AB + MO2-polr1c standard conditions Fig. 2 from Kwong et al., 2017
whole organism tp53 expression increased amount, abnormal AB + MO2-polr1c standard conditions Fig. 3 from Kwong et al., 2017
ethmoid cartilage decreased length, abnormal AB + MO2-polr1c standard conditions Fig. 1 from Kwong et al., 2017
ethmoid cartilage decreased width, abnormal AB + MO2-polr1c standard conditions Fig. 1 from Kwong et al., 2017
ethmoid cartilage decreased width, ameliorated AB + MO2-polr1c ultraviolet light Fig. 1 from Kwong et al., 2017
pharyngeal arch 3-7 dlx2a expression amount, ameliorated AB + MO2-polr1c ultraviolet light Fig. 2 from Kwong et al., 2017
pharyngeal arch 3-7 has fewer parts of type ectomesenchyme, ameliorated y1Tg + MO2-polr1c ultraviolet light Fig. 2 from Kwong et al., 2017
pharyngeal arch 3-7 has fewer parts of type ectomesenchyme, abnormal y1Tg + MO2-polr1c standard conditions Fig. 2 from Kwong et al., 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.